ID: 1039816659

View in Genome Browser
Species Human (GRCh38)
Location 8:41100523-41100545
Sequence CCTTTCCCAGGGAGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039816650_1039816659 9 Left 1039816650 8:41100491-41100513 CCAGTGGAGAGAGGATGGAAGAT No data
Right 1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG No data
1039816649_1039816659 10 Left 1039816649 8:41100490-41100512 CCCAGTGGAGAGAGGATGGAAGA No data
Right 1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG No data
1039816648_1039816659 11 Left 1039816648 8:41100489-41100511 CCCCAGTGGAGAGAGGATGGAAG No data
Right 1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039816659 Original CRISPR CCTTTCCCAGGGAGGCTGGG TGG Intergenic
No off target data available for this crispr