ID: 1039818875

View in Genome Browser
Species Human (GRCh38)
Location 8:41118834-41118856
Sequence TGAGTATCTTGCAGCCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039818875_1039818878 -3 Left 1039818875 8:41118834-41118856 CCACGCTGGCTGCAAGATACTCA No data
Right 1039818878 8:41118854-41118876 TCATTAATAACAAGTCCACGGGG No data
1039818875_1039818876 -5 Left 1039818875 8:41118834-41118856 CCACGCTGGCTGCAAGATACTCA No data
Right 1039818876 8:41118852-41118874 ACTCATTAATAACAAGTCCACGG No data
1039818875_1039818880 22 Left 1039818875 8:41118834-41118856 CCACGCTGGCTGCAAGATACTCA No data
Right 1039818880 8:41118879-41118901 GCAAATCCTCCAAGACTGTCAGG No data
1039818875_1039818877 -4 Left 1039818875 8:41118834-41118856 CCACGCTGGCTGCAAGATACTCA No data
Right 1039818877 8:41118853-41118875 CTCATTAATAACAAGTCCACGGG No data
1039818875_1039818881 26 Left 1039818875 8:41118834-41118856 CCACGCTGGCTGCAAGATACTCA No data
Right 1039818881 8:41118883-41118905 ATCCTCCAAGACTGTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039818875 Original CRISPR TGAGTATCTTGCAGCCAGCG TGG (reversed) Intergenic
No off target data available for this crispr