ID: 1039818880

View in Genome Browser
Species Human (GRCh38)
Location 8:41118879-41118901
Sequence GCAAATCCTCCAAGACTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039818874_1039818880 30 Left 1039818874 8:41118826-41118848 CCTCGAGTCCACGCTGGCTGCAA No data
Right 1039818880 8:41118879-41118901 GCAAATCCTCCAAGACTGTCAGG No data
1039818875_1039818880 22 Left 1039818875 8:41118834-41118856 CCACGCTGGCTGCAAGATACTCA No data
Right 1039818880 8:41118879-41118901 GCAAATCCTCCAAGACTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039818880 Original CRISPR GCAAATCCTCCAAGACTGTC AGG Intergenic
No off target data available for this crispr