ID: 1039819438

View in Genome Browser
Species Human (GRCh38)
Location 8:41123073-41123095
Sequence TTGAACAGGTTCAGTTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039819438_1039819447 25 Left 1039819438 8:41123073-41123095 CCTATCAAACTGAACCTGTTCAA No data
Right 1039819447 8:41123121-41123143 TTTATAGATGAGAAAAGTGAGGG No data
1039819438_1039819441 -10 Left 1039819438 8:41123073-41123095 CCTATCAAACTGAACCTGTTCAA No data
Right 1039819441 8:41123086-41123108 ACCTGTTCAACATTCCGATGGGG No data
1039819438_1039819446 24 Left 1039819438 8:41123073-41123095 CCTATCAAACTGAACCTGTTCAA No data
Right 1039819446 8:41123120-41123142 TTTTATAGATGAGAAAAGTGAGG 0: 8
1: 210
2: 1648
3: 6243
4: 14449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039819438 Original CRISPR TTGAACAGGTTCAGTTTGAT AGG (reversed) Intergenic
No off target data available for this crispr