ID: 1039821396

View in Genome Browser
Species Human (GRCh38)
Location 8:41138472-41138494
Sequence CAGTGATACAGGAGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039821396_1039821404 22 Left 1039821396 8:41138472-41138494 CCAGCTTCTCTCCTGTATCACTG No data
Right 1039821404 8:41138517-41138539 CTGTGACGTCCCAAAACAGAGGG No data
1039821396_1039821401 -9 Left 1039821396 8:41138472-41138494 CCAGCTTCTCTCCTGTATCACTG No data
Right 1039821401 8:41138486-41138508 GTATCACTGGAGGGCTGCTGTGG No data
1039821396_1039821403 21 Left 1039821396 8:41138472-41138494 CCAGCTTCTCTCCTGTATCACTG No data
Right 1039821403 8:41138516-41138538 GCTGTGACGTCCCAAAACAGAGG No data
1039821396_1039821405 23 Left 1039821396 8:41138472-41138494 CCAGCTTCTCTCCTGTATCACTG No data
Right 1039821405 8:41138518-41138540 TGTGACGTCCCAAAACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039821396 Original CRISPR CAGTGATACAGGAGAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr