ID: 1039824169

View in Genome Browser
Species Human (GRCh38)
Location 8:41158728-41158750
Sequence TTGGCGAGTTTGCTTTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039824166_1039824169 16 Left 1039824166 8:41158689-41158711 CCAAGGCTTAAAATGAGGCAGAA No data
Right 1039824169 8:41158728-41158750 TTGGCGAGTTTGCTTTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039824169 Original CRISPR TTGGCGAGTTTGCTTTTGGC TGG Intergenic
No off target data available for this crispr