ID: 1039827965

View in Genome Browser
Species Human (GRCh38)
Location 8:41190920-41190942
Sequence ATGAGTCCCCACATCTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039827965_1039827970 18 Left 1039827965 8:41190920-41190942 CCAAGAAAGATGTGGGGACTCAT No data
Right 1039827970 8:41190961-41190983 AGCGCCACTTCTTCCTGACTAGG No data
1039827965_1039827967 -10 Left 1039827965 8:41190920-41190942 CCAAGAAAGATGTGGGGACTCAT No data
Right 1039827967 8:41190933-41190955 GGGGACTCATCCAGCAGGCCTGG No data
1039827965_1039827972 25 Left 1039827965 8:41190920-41190942 CCAAGAAAGATGTGGGGACTCAT No data
Right 1039827972 8:41190968-41190990 CTTCTTCCTGACTAGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039827965 Original CRISPR ATGAGTCCCCACATCTTTCT TGG (reversed) Intergenic
No off target data available for this crispr