ID: 1039832094

View in Genome Browser
Species Human (GRCh38)
Location 8:41223585-41223607
Sequence AGGCTAAGGATATGCATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039832094_1039832102 8 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832102 8:41223616-41223638 CAGAGAGCCAAGAGGGAGGAAGG No data
1039832094_1039832098 0 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832098 8:41223608-41223630 GGATTCTCCAGAGAGCCAAGAGG No data
1039832094_1039832103 9 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832103 8:41223617-41223639 AGAGAGCCAAGAGGGAGGAAGGG No data
1039832094_1039832108 17 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832108 8:41223625-41223647 AAGAGGGAGGAAGGGAGGGTGGG No data
1039832094_1039832100 4 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832100 8:41223612-41223634 TCTCCAGAGAGCCAAGAGGGAGG No data
1039832094_1039832105 13 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832105 8:41223621-41223643 AGCCAAGAGGGAGGAAGGGAGGG No data
1039832094_1039832104 12 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832104 8:41223620-41223642 GAGCCAAGAGGGAGGAAGGGAGG No data
1039832094_1039832099 1 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832099 8:41223609-41223631 GATTCTCCAGAGAGCCAAGAGGG No data
1039832094_1039832107 16 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832107 8:41223624-41223646 CAAGAGGGAGGAAGGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039832094 Original CRISPR AGGCTAAGGATATGCATTGT TGG (reversed) Intergenic