ID: 1039832098

View in Genome Browser
Species Human (GRCh38)
Location 8:41223608-41223630
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039832094_1039832098 0 Left 1039832094 8:41223585-41223607 CCAACAATGCATATCCTTAGCCT No data
Right 1039832098 8:41223608-41223630 GGATTCTCCAGAGAGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039832098 Original CRISPR GGATTCTCCAGAGAGCCAAG AGG Intergenic
No off target data available for this crispr