ID: 1039834099

View in Genome Browser
Species Human (GRCh38)
Location 8:41242515-41242537
Sequence CTTATGTGAGTTTTGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039834099_1039834104 0 Left 1039834099 8:41242515-41242537 CCTGAAGACAAAACTCACATAAG No data
Right 1039834104 8:41242538-41242560 TGTTGGGGGCCTCCTAAGACTGG No data
1039834099_1039834105 1 Left 1039834099 8:41242515-41242537 CCTGAAGACAAAACTCACATAAG No data
Right 1039834105 8:41242539-41242561 GTTGGGGGCCTCCTAAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039834099 Original CRISPR CTTATGTGAGTTTTGTCTTC AGG (reversed) Intergenic
No off target data available for this crispr