ID: 1039834204

View in Genome Browser
Species Human (GRCh38)
Location 8:41243526-41243548
Sequence GGGTTTTTGCAGATGTAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039834198_1039834204 13 Left 1039834198 8:41243490-41243512 CCCTGGTACCTGTGAATGTGACC 0: 29
1: 127
2: 288
3: 744
4: 1465
Right 1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG No data
1039834200_1039834204 5 Left 1039834200 8:41243498-41243520 CCTGTGAATGTGACCTTACTTGC No data
Right 1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG No data
1039834196_1039834204 19 Left 1039834196 8:41243484-41243506 CCTAACCCCTGGTACCTGTGAAT 0: 27
1: 102
2: 374
3: 995
4: 2170
Right 1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG No data
1039834199_1039834204 12 Left 1039834199 8:41243491-41243513 CCTGGTACCTGTGAATGTGACCT 0: 31
1: 176
2: 504
3: 1224
4: 2089
Right 1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG No data
1039834197_1039834204 14 Left 1039834197 8:41243489-41243511 CCCCTGGTACCTGTGAATGTGAC 0: 27
1: 97
2: 200
3: 512
4: 1166
Right 1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG No data
1039834203_1039834204 -8 Left 1039834203 8:41243511-41243533 CCTTACTTGCAAATAGGGTTTTT No data
Right 1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039834204 Original CRISPR GGGTTTTTGCAGATGTAGTT AGG Intergenic
No off target data available for this crispr