ID: 1039838133

View in Genome Browser
Species Human (GRCh38)
Location 8:41273865-41273887
Sequence GGTGGTGCCAGCCCACATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039838133_1039838139 12 Left 1039838133 8:41273865-41273887 CCTCAATGTGGGCTGGCACCACC No data
Right 1039838139 8:41273900-41273922 AGGGCAGTCAGAATAAAGCAAGG No data
1039838133_1039838134 -8 Left 1039838133 8:41273865-41273887 CCTCAATGTGGGCTGGCACCACC No data
Right 1039838134 8:41273880-41273902 GCACCACCCAATCAGCTGCGAGG No data
1039838133_1039838141 25 Left 1039838133 8:41273865-41273887 CCTCAATGTGGGCTGGCACCACC No data
Right 1039838141 8:41273913-41273935 TAAAGCAAGGAGAAGAAGGCAGG No data
1039838133_1039838140 21 Left 1039838133 8:41273865-41273887 CCTCAATGTGGGCTGGCACCACC No data
Right 1039838140 8:41273909-41273931 AGAATAAAGCAAGGAGAAGAAGG No data
1039838133_1039838135 -7 Left 1039838133 8:41273865-41273887 CCTCAATGTGGGCTGGCACCACC No data
Right 1039838135 8:41273881-41273903 CACCACCCAATCAGCTGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039838133 Original CRISPR GGTGGTGCCAGCCCACATTG AGG (reversed) Intronic