ID: 1039838135

View in Genome Browser
Species Human (GRCh38)
Location 8:41273881-41273903
Sequence CACCACCCAATCAGCTGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039838133_1039838135 -7 Left 1039838133 8:41273865-41273887 CCTCAATGTGGGCTGGCACCACC No data
Right 1039838135 8:41273881-41273903 CACCACCCAATCAGCTGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039838135 Original CRISPR CACCACCCAATCAGCTGCGA GGG Intronic