ID: 1039838135 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:41273881-41273903 |
| Sequence | CACCACCCAATCAGCTGCGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039838133_1039838135 | -7 | Left | 1039838133 | 8:41273865-41273887 | CCTCAATGTGGGCTGGCACCACC | No data | ||
| Right | 1039838135 | 8:41273881-41273903 | CACCACCCAATCAGCTGCGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039838135 | Original CRISPR | CACCACCCAATCAGCTGCGA GGG | Intronic | ||