ID: 1039838140

View in Genome Browser
Species Human (GRCh38)
Location 8:41273909-41273931
Sequence AGAATAAAGCAAGGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039838137_1039838140 0 Left 1039838137 8:41273886-41273908 CCCAATCAGCTGCGAGGGCAGTC No data
Right 1039838140 8:41273909-41273931 AGAATAAAGCAAGGAGAAGAAGG No data
1039838138_1039838140 -1 Left 1039838138 8:41273887-41273909 CCAATCAGCTGCGAGGGCAGTCA No data
Right 1039838140 8:41273909-41273931 AGAATAAAGCAAGGAGAAGAAGG No data
1039838133_1039838140 21 Left 1039838133 8:41273865-41273887 CCTCAATGTGGGCTGGCACCACC No data
Right 1039838140 8:41273909-41273931 AGAATAAAGCAAGGAGAAGAAGG No data
1039838136_1039838140 3 Left 1039838136 8:41273883-41273905 CCACCCAATCAGCTGCGAGGGCA No data
Right 1039838140 8:41273909-41273931 AGAATAAAGCAAGGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039838140 Original CRISPR AGAATAAAGCAAGGAGAAGA AGG Intronic