ID: 1039838446

View in Genome Browser
Species Human (GRCh38)
Location 8:41276449-41276471
Sequence TCTGTTAAGCTGCCATTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039838446_1039838451 9 Left 1039838446 8:41276449-41276471 CCTTGCAATGGCAGCTTAACAGA 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1039838451 8:41276481-41276503 TCCCAGCAGGAGCCAATGTCTGG No data
1039838446_1039838447 -4 Left 1039838446 8:41276449-41276471 CCTTGCAATGGCAGCTTAACAGA 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1039838447 8:41276468-41276490 CAGACCCCACTGTTCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039838446 Original CRISPR TCTGTTAAGCTGCCATTGCA AGG (reversed) Intronic
900822600 1:4900712-4900734 TCTGTTAAGATACCACTGCAGGG - Intergenic
903521089 1:23950396-23950418 GCTGTAAGACTGCCATTGCAGGG + Intergenic
904355428 1:29935912-29935934 TCAGGTAAGCTGTCACTGCAGGG + Intergenic
905436420 1:37958633-37958655 TCTGCTCAGAGGCCATTGCAGGG + Intronic
907750195 1:57255788-57255810 TCTGTTGAGCTGCCATCTGAAGG + Intronic
907855260 1:58297124-58297146 CCTATTAAGCTTCCATTTCAAGG - Intronic
909073354 1:71023549-71023571 TTAGTTTAGCTGCTATTGCACGG + Intronic
909442995 1:75718448-75718470 TCTGTTAATGTCCCATTCCAAGG - Intergenic
909732932 1:78917991-78918013 TCTTTTTAGCTGCTTTTGCATGG - Exonic
912322262 1:108725146-108725168 TCTGTAAAGCCTCCATAGCATGG - Intronic
917724512 1:177816085-177816107 TCTTTTAGACTGCCATTGCCTGG - Intergenic
918253550 1:182726368-182726390 TCTGATAAGATGCCATGCCACGG + Intergenic
923010643 1:230084936-230084958 TCTGTTCAGCTGCAAGAGCAAGG - Intronic
924547629 1:245045057-245045079 TCTGTGATGCTGCCATCACACGG - Intronic
1063225197 10:4009162-4009184 TCTGTAAAGCTGGGATAGCATGG - Intergenic
1066294230 10:34040319-34040341 TCTGAAGAGCTGCAATTGCAAGG - Intergenic
1067288737 10:44926505-44926527 TCAGTTAGGCTGACACTGCAGGG + Intronic
1069921277 10:71817177-71817199 TCTTTTAGCCTGCCCTTGCATGG - Exonic
1072552142 10:96487219-96487241 TCTGTTAAGCAGCCAGTGCCAGG + Intronic
1074212129 10:111344950-111344972 TCTGTTTAGCTGCAAGGGCATGG - Intergenic
1074423268 10:113328095-113328117 TCTGTAAATCAGCCATAGCAAGG + Intergenic
1076250804 10:128982563-128982585 TTTGCTAAACTGCAATTGCAAGG + Intergenic
1079398164 11:20083952-20083974 TCTGGTAAGCTGCTAAGGCAGGG - Intronic
1082919586 11:58478563-58478585 TCTATTAAGCTGCCATTAAAAGG - Intergenic
1083642025 11:64150781-64150803 TCTGGAAAGCTGCCAGGGCATGG + Intronic
1085070484 11:73539795-73539817 TGTGTTGGGCTGCAATTGCAAGG + Intronic
1085172441 11:74460772-74460794 TCTTTTAAGATACCATTCCATGG - Intronic
1086031633 11:82365742-82365764 TCTCTTAAGCTGGCACAGCAAGG - Intergenic
1087271313 11:96114789-96114811 TCTGCTGAGCTACCATGGCAAGG + Intronic
1088168168 11:106963530-106963552 TCTGTTTATCTCCTATTGCAGGG - Intronic
1089671428 11:120059748-120059770 TTTGTTCATCAGCCATTGCAAGG + Intergenic
1089928876 11:122288352-122288374 TCTGTGAAGGAGCCATTGCTGGG - Intergenic
1092254459 12:6918679-6918701 TCTGTTAAGTTGCCACTGGAAGG + Intronic
1104037548 12:125108023-125108045 TCTGTGAAGCTGTCATTACATGG + Intronic
1106686764 13:32068517-32068539 TCTGCTAAGATGCGATTACATGG - Intronic
1112292046 13:98152880-98152902 CCTTTTAAGCTGGCCTTGCAGGG + Intronic
1112760591 13:102689981-102690003 TCAGAAAAGCTGCCATTTCAGGG - Intronic
1114271655 14:21103898-21103920 TCTCTGAAGCTGCCAGCGCAGGG - Intronic
1118429739 14:65704933-65704955 TAAGTTTAGCTGCCTTTGCAAGG + Intronic
1121228663 14:92340513-92340535 TGTGTTCAGCTGGCCTTGCAGGG + Intronic
1121662139 14:95643090-95643112 ACTGTTAAGGTGACAGTGCATGG - Intergenic
1122449074 14:101789328-101789350 TCTGGTAAGCAGCCTTTGCAAGG + Intronic
1125051551 15:35303975-35303997 TCTTTTAAGTTGCCATTACTTGG + Intronic
1125093788 15:35827790-35827812 TCTGTTATTATGCCATTTCAAGG + Intergenic
1125597395 15:40895579-40895601 TCAGTTAAGCTGGGATTGCTGGG + Intronic
1126216863 15:46165482-46165504 TCTTTGGAGCTGCCATTGTATGG + Intergenic
1127691836 15:61404181-61404203 TCTGTCATGATGCCATTGCCTGG + Intergenic
1132389330 15:101427143-101427165 TCAGTCAAGCTGCCCTTGCTAGG - Intronic
1135181447 16:20277979-20278001 TCTGTGAAGTTGACATTGAACGG + Intergenic
1135691218 16:24539539-24539561 TCTCTTAAGCAGGGATTGCACGG - Intronic
1137915430 16:52424702-52424724 TCTGTTAAGCTGCCATCATTTGG - Intergenic
1140081594 16:71753306-71753328 TATGTTAGGAAGCCATTGCAGGG - Intronic
1143814202 17:9498571-9498593 TCTGTGAAGCTGTGACTGCAAGG + Intronic
1144867511 17:18346183-18346205 TCTGCTTGGCTGGCATTGCATGG - Intronic
1145282288 17:21476898-21476920 TCTGTTAAGAAGCCAGTCCATGG - Intergenic
1145395150 17:22488703-22488725 TCTGTTAAGAAGCCAATCCATGG + Intergenic
1150429166 17:65101671-65101693 ACTGTTAAGCTGCCCTTGGGTGG - Intergenic
1151470569 17:74315171-74315193 TCTGTTGAGCTGCGGTTTCAGGG - Intergenic
1152867598 17:82733732-82733754 TCTGTCAAGATGCGATAGCAGGG + Intergenic
1153890994 18:9514987-9515009 TCTGTTAAACTGGCAAGGCAGGG - Intronic
1154071787 18:11159317-11159339 TCGGTTAAGCCACCATAGCAGGG - Intergenic
1156568338 18:38221971-38221993 TCTGAAAAGCTGTCATTGCCCGG + Intergenic
1156718472 18:40041147-40041169 TATCTTAAACTGCCATTCCATGG + Intergenic
1157870216 18:51223205-51223227 TCTGTAAAATTGCCATTTCAGGG + Intergenic
1158999045 18:62953902-62953924 TAGGTTAAGTTGCCATTTCAGGG + Intronic
1159407297 18:68020756-68020778 CCTGGTAAGCTGCCATAGCTTGG - Intergenic
1160753641 19:747086-747108 TCTGTGAAGCTGCCGTGACATGG - Exonic
926736607 2:16078309-16078331 TGTGCTAAGCTTCCAATGCAGGG - Intergenic
931188627 2:59977872-59977894 TTTGTTTAGGTGGCATTGCAGGG - Intergenic
933494749 2:83035513-83035535 TCTGTTTAATTGCCTTTGCAGGG - Intergenic
938737430 2:134199139-134199161 TATGTTAAGCTGCTATTTCTTGG + Intronic
942787290 2:179714444-179714466 TTTGTTAAGGAGGCATTGCATGG - Intronic
1171486029 20:25486887-25486909 TCTGTTAAGCTGGTAATTCATGG - Intronic
1173737383 20:45372043-45372065 ACTGTTAAGCAGCCATTTCTAGG + Intronic
1180996303 22:19967368-19967390 TCTTTTCAGCTGACATTGCTAGG + Intronic
1181983539 22:26783260-26783282 TGTGTAAAGCTGCCATTGGCAGG + Intergenic
1184807419 22:46804058-46804080 GCTGCTGAGCTGCCATTGGATGG - Intronic
951476200 3:23108862-23108884 TTTGTTATGTTGCAATTGCAAGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
955070407 3:55568027-55568049 TCTCTTCAGCTGCCTTGGCAGGG + Intronic
957008215 3:74974893-74974915 TCTGCTATAATGCCATTGCATGG - Intergenic
958888274 3:99753357-99753379 TCTGTGAGGCTGCCATCACAAGG + Intronic
959786873 3:110309910-110309932 TGTGTTAATCTGGCATTCCAGGG + Intergenic
963469810 3:145726201-145726223 TGTGTTAAGCTGCTTTTACAAGG - Intergenic
970428353 4:15965484-15965506 TATGATAAGTTCCCATTGCAGGG - Intronic
971922509 4:32960644-32960666 ATTGTTAAGATGCCATTGAAAGG + Intergenic
974163718 4:58173138-58173160 TCTGTTTTGCAGCCATTACAAGG + Intergenic
975370388 4:73579159-73579181 ATTGTTAGGCTGCCATTGAATGG - Intronic
979755175 4:124331321-124331343 TATGTCAAGCTTCCATTTCATGG + Intergenic
982350220 4:154407307-154407329 TCTGTTAATTTGCTATTGAAAGG + Intronic
983220834 4:165043080-165043102 ACTGTCAAGCTGTAATTGCAAGG + Intergenic
988496667 5:31751334-31751356 TCAGTTAAGAGGCCCTTGCAGGG + Intronic
990683341 5:58270892-58270914 TCTGTTGAGTTTCCATTGGAGGG - Intergenic
992307218 5:75454007-75454029 TCTGTTCTGATGCCATTGGATGG - Intronic
993998799 5:94753837-94753859 TGTGTTCAGTTGCCAGTGCATGG + Intronic
994306135 5:98207012-98207034 TCCGTGCAGCTGCCTTTGCAAGG + Intergenic
995191211 5:109320601-109320623 TCTTTTTAGTTGCCATTGCCAGG + Intergenic
996195390 5:120600097-120600119 TCTGTTATGATTCCATTTCAGGG + Intronic
999238932 5:150116270-150116292 TCTATTAGGCGGTCATTGCAAGG - Intronic
999625902 5:153519964-153519986 TCTGTTAATCTGCCTGTCCAGGG + Intronic
1000570651 5:162909254-162909276 TCTGTTAAGCTGGCATCAAATGG - Intergenic
1001572092 5:172736646-172736668 ACTGTTACGCTGCCACTCCATGG + Intergenic
1003346294 6:5270972-5270994 TCTGTTAAGCTCCCTTAGTATGG + Intronic
1003832563 6:10029971-10029993 ACAGTTTAGCTGCAATTGCATGG + Intronic
1003871641 6:10408692-10408714 TATGTTTAGCAGCCCTTGCATGG - Intronic
1006267174 6:32935190-32935212 TGATTTAAGCTGCCATTGCTAGG - Intronic
1008232366 6:48997832-48997854 TCTGTTAGGCTGCCATTGTGGGG - Intergenic
1010890954 6:81309802-81309824 TTTGTAAAGCTTCCATTGCTTGG + Intergenic
1013610590 6:111790979-111791001 TCAGTTAAGATGCAATTGCGAGG - Intronic
1013666592 6:112355807-112355829 GGTCTTAAGCTGCCCTTGCACGG - Intergenic
1014827569 6:126064023-126064045 TTTCTGAAGCTGCCATTGCAGGG + Intergenic
1014984722 6:127990104-127990126 TGAGTTAGGCTGCCATTGTAGGG - Intronic
1016742666 6:147544603-147544625 TCATTTATGCTGACATTGCAGGG + Intronic
1017915363 6:158827398-158827420 TCTGCTAATCTGCCATGGCCTGG - Intergenic
1019425295 7:973020-973042 TCTGATAAGCCTCCATTTCAAGG + Intronic
1022911102 7:34900230-34900252 TCAGATGAGATGCCATTGCAGGG + Intergenic
1031882923 7:127217325-127217347 TTTGGTAAGCTGCCTTTTCAAGG - Intronic
1035698114 8:1615563-1615585 TCTTTAAAGCAGCCATTGTAAGG + Intronic
1035698125 8:1615751-1615773 TCTTTAAAGCAGCCATTGTAAGG + Intronic
1035698128 8:1615815-1615837 TCTTTAAAGCAGCCATTGTAAGG + Intronic
1039838446 8:41276449-41276471 TCTGTTAAGCTGCCATTGCAAGG - Intronic
1040958581 8:53006066-53006088 TCTGTTCAGCTGCCCCTGCCTGG - Intergenic
1042375871 8:68051367-68051389 TCTTTTAAGCTGCAGGTGCAAGG + Intronic
1042577720 8:70239257-70239279 TATATTCAGTTGCCATTGCAAGG - Intronic
1045959263 8:107948044-107948066 TGTTTTTAGCTGCCATTGCCAGG - Intronic
1046292033 8:112175255-112175277 TCAGTTAAGCTGTCCTGGCATGG + Intergenic
1047025174 8:120815874-120815896 TCTGTGAAGCTTGCATTGTAGGG + Intergenic
1047721997 8:127649660-127649682 GCTGTTGAGCAGCCATTGAATGG + Intergenic
1048528492 8:135226316-135226338 TCTGAGCAGCTGCCCTTGCACGG - Intergenic
1050190593 9:3021227-3021249 TCTTTTAAGCTTACATTCCATGG - Intergenic
1052462088 9:28777804-28777826 TCTGATAAGCTGCCAAAGCAAGG + Intergenic
1052962484 9:34311874-34311896 TGTGTTAAGTAGACATTGCAAGG - Intronic
1055006652 9:71515230-71515252 TCTGTTATGCTGCACTTGTAGGG - Intergenic
1055293116 9:74804766-74804788 GGTCTTAAGCTGCCCTTGCACGG + Intronic
1056400899 9:86226205-86226227 TCTGTTAAGATGTCAATGTAGGG + Intronic
1058200650 9:102035467-102035489 CCTGTTAAGCTGACATAGCAGGG + Intergenic
1061914135 9:133740278-133740300 TCTGTGAAACTGACATGGCAGGG - Intergenic
1061915027 9:133745709-133745731 TGTGTTCTGCTGCCATTGGATGG + Intergenic
1186601013 X:11037336-11037358 TCTGTCAAGGTACCATGGCATGG + Intergenic
1186952274 X:14640011-14640033 TCTGTTCCTATGCCATTGCATGG + Intronic
1192451326 X:71246851-71246873 TCTTTTAGGCTGCTATTGCTGGG - Intronic
1193174718 X:78378906-78378928 TCTGGTAAGCTGACATTTCTTGG + Intergenic
1195823201 X:108969723-108969745 TCTGTTATGCAGCCATTGCCAGG - Intergenic
1197388457 X:125829080-125829102 ACTGTTTTGCTCCCATTGCAAGG - Intergenic
1199179128 X:144832844-144832866 GTTGTTAAACTGCCATTGCAGGG - Intergenic