ID: 1039839033

View in Genome Browser
Species Human (GRCh38)
Location 8:41280468-41280490
Sequence CAGGGCATTCAGCTTGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039839033_1039839036 -8 Left 1039839033 8:41280468-41280490 CCGGCCTCAAGCTGAATGCCCTG 0: 1
1: 0
2: 1
3: 16
4: 197
Right 1039839036 8:41280483-41280505 ATGCCCTGACTCCGGCTTCCAGG No data
1039839033_1039839041 10 Left 1039839033 8:41280468-41280490 CCGGCCTCAAGCTGAATGCCCTG 0: 1
1: 0
2: 1
3: 16
4: 197
Right 1039839041 8:41280501-41280523 CCAGGTCCTCAGACCCTCCCTGG No data
1039839033_1039839042 11 Left 1039839033 8:41280468-41280490 CCGGCCTCAAGCTGAATGCCCTG 0: 1
1: 0
2: 1
3: 16
4: 197
Right 1039839042 8:41280502-41280524 CAGGTCCTCAGACCCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039839033 Original CRISPR CAGGGCATTCAGCTTGAGGC CGG (reversed) Intronic
900618037 1:3574072-3574094 GAGGGCCTCCTGCTTGAGGCAGG + Intronic
901306649 1:8237661-8237683 CAGGGAATTCAGCTTCAGATGGG + Intergenic
902232287 1:15035807-15035829 AAGTGCATTCAGCTCGAGGCTGG - Intronic
907273033 1:53301759-53301781 AAGGTCATGTAGCTTGAGGCAGG + Intronic
912549939 1:110479055-110479077 CAGGGCCATCAGCATGGGGCAGG + Intergenic
915891782 1:159780593-159780615 CAGGGCATCCAGCGTGAAGGAGG + Intergenic
916900640 1:169218895-169218917 CAGGGCATTTATCTTAAGGATGG - Intronic
917111180 1:171549788-171549810 ATGGGCATACTGCTTGAGGCCGG - Intronic
917576136 1:176323629-176323651 CAGAGCATTCAGTTTGAGGGTGG - Intergenic
918187911 1:182144067-182144089 CAGGGCAGTGTGGTTGAGGCTGG - Intergenic
920673056 1:208019206-208019228 CAGACCATACAGCTTGAGGATGG + Intergenic
921645716 1:217614522-217614544 CATGCAATTCAGCTTGAGCCTGG + Intronic
922722409 1:227905681-227905703 AGGGGCATTCAGCTTGGGCCTGG - Intergenic
922819415 1:228473802-228473824 TAGAAGATTCAGCTTGAGGCTGG - Intergenic
923944322 1:238865275-238865297 CAGGTTTTTCAGCTTGAGGTTGG + Intergenic
924114202 1:240729517-240729539 CAGGGCTTTCAGCTGCAGTCGGG - Intergenic
924625304 1:245692478-245692500 CAGGGCATCGAGGCTGAGGCAGG + Intronic
1064657208 10:17568111-17568133 AAGGGCATTGGCCTTGAGGCAGG + Intergenic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1069137749 10:64785420-64785442 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1069842484 10:71348491-71348513 CAGGGCATGGAGCCTGAGTCAGG - Intronic
1071765117 10:88655344-88655366 CATGGCATGCAGCTGGAGACTGG - Intergenic
1074115178 10:110451764-110451786 CAGGGCATGCACTGTGAGGCTGG + Intergenic
1074403087 10:113157850-113157872 AAGGGCATTTGGCTTGAAGCGGG + Intronic
1074893321 10:117753572-117753594 CAGGGCATATGGCCTGAGGCCGG - Intergenic
1075847294 10:125555184-125555206 CAGGGCCTTCTGCGTGGGGCTGG - Intergenic
1076122734 10:127949182-127949204 CAGGGTCTTCAGCTTGAAGATGG + Intronic
1076627523 10:131831176-131831198 CAGGGAATACAGCCCGAGGCTGG - Intergenic
1076724935 10:132408857-132408879 CAGGGCATTGGGCCTGTGGCCGG + Intronic
1076755839 10:132571169-132571191 CTGGGAATGCAGCATGAGGCAGG + Intronic
1076824744 10:132961184-132961206 CAGGGCCTGCAGCCTGAGGCTGG - Intergenic
1077315641 11:1918285-1918307 CCGGGCACTCAGCGGGAGGCAGG + Intergenic
1077481451 11:2816707-2816729 CAGGGCAGTGGGCCTGAGGCGGG - Intronic
1079108021 11:17586385-17586407 CCGAGCATCCAGATTGAGGCAGG + Intronic
1080633824 11:34105864-34105886 CAGAGCCTTCATCCTGAGGCCGG - Intronic
1081374505 11:42342900-42342922 CAGGACATTCATGTTGAGTCAGG - Intergenic
1081829143 11:46091755-46091777 CAAGTCATCCAGCTTGAAGCTGG - Intronic
1085383708 11:76143316-76143338 CAGGGCATCCAGCCTGGCGCTGG + Intergenic
1087005477 11:93466752-93466774 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1087277647 11:96176446-96176468 CAGGGGACTCATCTTGAGGTAGG + Intronic
1087533953 11:99419971-99419993 CAAGGCATTCAGTTTAAGGAAGG + Intronic
1090451231 11:126808167-126808189 TAGGGCCCTCATCTTGAGGCTGG + Intronic
1090583294 11:128183085-128183107 CAGGGCACACAGCTTGAAACCGG + Intergenic
1091015492 11:132047579-132047601 CAGGGGAGTCAGCTAGAGCCTGG + Intronic
1091368134 11:135038682-135038704 CAGGGCCTTCAGCTGAGGGCAGG + Intergenic
1094082981 12:26557589-26557611 GTAGGCATTCAGCTTGATGCTGG - Intronic
1096754261 12:53785620-53785642 CAGGGCAATCTTCTAGAGGCAGG + Intergenic
1099860383 12:88218497-88218519 CAGTGCAGTCAGCCTGAGGTGGG - Intergenic
1100386507 12:94109157-94109179 GAGGGGCCTCAGCTTGAGGCAGG + Intergenic
1100822010 12:98440296-98440318 GAAGACATTCAGCTTGAGGGTGG - Intergenic
1101148824 12:101866337-101866359 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1102225827 12:111227673-111227695 CAGGGCAGCCAGCTGGGGGCAGG + Intronic
1103292219 12:119855749-119855771 CAGGCCATTCACCTGGAGGAAGG + Intronic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1107217210 13:37935191-37935213 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1110818218 13:79884334-79884356 CAGGGTATTGAGCTGGAGGATGG + Intergenic
1111182593 13:84687904-84687926 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1111606468 13:90546024-90546046 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1112547216 13:100382488-100382510 CAGGCTTTTCAGCTTGAGGGTGG + Intronic
1119819844 14:77605747-77605769 CAGGACATTCACCTCCAGGCTGG + Intronic
1120999414 14:90440721-90440743 GAGGGCATACATCTTGGGGCTGG + Intergenic
1121993573 14:98584421-98584443 CAGGGCATTCAGCTTCAGAGAGG - Intergenic
1122743492 14:103885155-103885177 AAGGGCATCCGGCTTGGGGCTGG - Intergenic
1122951457 14:105047388-105047410 CAGGGCATGGTGCTGGAGGCAGG + Intergenic
1129178253 15:73855430-73855452 CAGGGAGTTCAACTTGGGGCAGG + Intergenic
1131184926 15:90265891-90265913 CCGGGCCCTCAGCTTGAAGCAGG + Intronic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132862871 16:2080090-2080112 GGGAGCATTCAGCTTGAGGCTGG + Intronic
1133846092 16:9455066-9455088 CTGGGCATTGAGCTGGAGCCAGG - Intergenic
1135256987 16:20948809-20948831 CAGGCTTTTCAGCTTGAGGGTGG - Intronic
1135557999 16:23453156-23453178 CAGCGCACTCAGTTTGCGGCTGG + Exonic
1137023304 16:35451410-35451432 CTGGGCCTGCAGCTTTAGGCTGG - Intergenic
1137270738 16:46900850-46900872 CAGGACCCTCCGCTTGAGGCTGG - Intronic
1138597140 16:58035078-58035100 AAGGGAATGCAGCTGGAGGCCGG - Intronic
1138660902 16:58516273-58516295 TAGGGCCTCCAGCGTGAGGCCGG - Exonic
1139876740 16:70152044-70152066 CCGGGCATTGAGCTTGAGGTGGG + Intronic
1140381584 16:74493099-74493121 CTGGGCAATCAGCTTTTGGCGGG + Exonic
1142301808 16:89262982-89263004 CAGGCATTTCAGCTTGAGGGTGG + Intergenic
1143384795 17:6522622-6522644 CAGAGCGTCCAGCATGAGGCAGG + Intronic
1144477007 17:15597019-15597041 CATGGCATACAGCTTGAGTAGGG + Intronic
1144921233 17:18766335-18766357 CATGGCATACAGCTTGAGTAGGG - Intronic
1148341931 17:46878418-46878440 CAGGGCAGTCTGCTGGATGCTGG + Intronic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1152011544 17:77721897-77721919 CAGTGCCTCCAGCTTGGGGCTGG - Intergenic
1154246224 18:12702326-12702348 CAGAGCTTTGAGTTTGAGGCAGG - Intronic
1155047237 18:22113630-22113652 CTGGGCATGCAGCCTGAGGCTGG + Intergenic
1158021382 18:52846244-52846266 CAAGGAATTCAGCTTCAGCCAGG + Intronic
1158820205 18:61150604-61150626 TCAGGCATTCAGTTTGAGGCAGG - Intergenic
1158900141 18:61954692-61954714 GAGGACTTTCAGCTAGAGGCAGG + Intergenic
1159030577 18:63226358-63226380 CAGGCTTTTCAGCTTGAGGGTGG + Intronic
1159587022 18:70290702-70290724 CAGGGCTTTCCGCTTGTGCCTGG + Intronic
1160167522 18:76527453-76527475 CACGTCCTTCAGATTGAGGCTGG + Intergenic
1160867458 19:1262203-1262225 CATGGCTTTTGGCTTGAGGCCGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1163413563 19:17172061-17172083 CAGCGTGTTCAGCATGAGGCAGG + Intronic
1164947357 19:32307658-32307680 CAGGCCATGCAGATTGAGGGAGG - Intergenic
1165012598 19:32859684-32859706 CACGGCATGGAGCTGGAGGCAGG - Intronic
1166108246 19:40608091-40608113 CAGGGGTTTGAGCTGGAGGCTGG - Intronic
1166202939 19:41250296-41250318 TAGGGCATTCAGATTGGGGCTGG + Intronic
1166766488 19:45254350-45254372 CAGGGCAGCCAGCTGGAGGTGGG - Intronic
1167305183 19:48704026-48704048 CCGGGCACTCATCTTGAGGGAGG - Exonic
1167716398 19:51144994-51145016 CAGGGCCTTCAGCTCAGGGCAGG + Intronic
1167774255 19:51544566-51544588 CAGGGCCTGCAGCTTGGGGCAGG - Intergenic
925027820 2:623494-623516 CTGGGCATTCAACGTGAGACCGG + Intergenic
925292222 2:2755573-2755595 GAAGACATTCAGCATGAGGCTGG - Intergenic
925372902 2:3360767-3360789 GAGGGGCTTCAGCTTGAAGCAGG + Intronic
926693087 2:15750929-15750951 CAGGGCAGTAGGCTGGAGGCAGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928288094 2:30010746-30010768 CACTGCATGCAGCCTGAGGCAGG - Intergenic
929142805 2:38681222-38681244 TATGGCATTTAGCTTGAGGATGG + Intronic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
930106087 2:47640563-47640585 AAGGGAAATCAGCGTGAGGCAGG + Intergenic
931428321 2:62190810-62190832 CATGGCAGTCCACTTGAGGCTGG - Intergenic
931462902 2:62463703-62463725 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
934755646 2:96822908-96822930 CAGGGCTTTCTGCTTGACGTTGG + Intronic
937473972 2:122197917-122197939 TAGGGCTTCCAGCATGAGGCAGG + Intergenic
938068108 2:128292691-128292713 CAGGGCATTCAGTGTGCAGCAGG + Intronic
938966156 2:136390434-136390456 CAGAGCATTCAGCTTTTGGAGGG - Intergenic
939717961 2:145609413-145609435 CTGAGCAATCAGGTTGAGGCTGG + Intergenic
940143464 2:150521439-150521461 TAGTGCATTAAGCTTGAGGGTGG - Intronic
943841872 2:192593940-192593962 CAGGGAATTTATCTTGAGGTAGG - Intergenic
946563567 2:220939829-220939851 CAGGTTTTTCAGCTTGAGGATGG - Intergenic
947734380 2:232447104-232447126 CAGGGCATTCATCCTGGAGCAGG + Intergenic
1169135486 20:3194725-3194747 CAGGGCATTCAGGCTCATGCAGG - Intronic
1170747584 20:19114306-19114328 CAGGGCATTGAGTTGGAGCCCGG + Intergenic
1173225530 20:41160355-41160377 CAGGGCACACAGCATGTGGCTGG - Intronic
1173616103 20:44403898-44403920 CTGGCCATTCAGCAGGAGGCTGG - Intronic
1177703790 21:24674223-24674245 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1180999735 22:19982419-19982441 CAGGCCATGCAGCTTGGGGAGGG - Intronic
1182897809 22:33873425-33873447 CAGGGCTTTCAGCCGGGGGCAGG - Intronic
1182923191 22:34098907-34098929 GAGGCCATTAAGCCTGAGGCTGG + Intergenic
1183601685 22:38843847-38843869 CAGGAACTTCAGCGTGAGGCGGG + Exonic
1184639943 22:45865368-45865390 CAGCACATTCACCTTCAGGCAGG + Intergenic
1185239236 22:49733758-49733780 CAGGGCTTTGAGCTGGATGCAGG + Intergenic
951767659 3:26217414-26217436 CAGGGCATGCATGATGAGGCTGG + Intergenic
953625340 3:44566285-44566307 CAGGACCTTGAGATTGAGGCAGG + Intronic
954614547 3:51962941-51962963 AAGGGCAGCCAGCATGAGGCTGG - Intronic
957210044 3:77247907-77247929 CAGGCTTTTCAGCTTGAGGGTGG - Intronic
960245888 3:115400009-115400031 CATGGCATTTAGCTTCAGCCTGG + Intergenic
960294942 3:115931372-115931394 CAGGTCACTCAGCTGGGGGCAGG - Intronic
960965682 3:123103129-123103151 CTGGGCATCCAGCCTGAGGGTGG - Intronic
960996381 3:123343255-123343277 CAGGACACTCAGCTACAGGCGGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961426421 3:126851933-126851955 CAGGGCAAGCAACCTGAGGCTGG - Intronic
963410612 3:144922352-144922374 CAGGCTTTTCAGCTTGAGGATGG + Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
967627898 3:191707870-191707892 CAGGTTTTTCAGCTTGAGGGTGG - Intergenic
968757278 4:2423369-2423391 CAGGGCCTTAAGCTTGTGACAGG - Intronic
969279458 4:6160507-6160529 CAGGGCATGCAGCATGCGGGAGG - Intronic
969697724 4:8744590-8744612 CATGGGGTTCAGCTGGAGGCTGG - Intergenic
970423435 4:15926003-15926025 CAGGGCACCCAGCTGGAGCCAGG - Intergenic
972066492 4:34952867-34952889 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
982862034 4:160464097-160464119 CAGGATTTTCAGCTTGAGGGTGG + Intergenic
984292115 4:177808480-177808502 CAGGCTTTTCAGCTTGAGGGTGG + Intronic
985023030 4:185712082-185712104 CAGGCTTTTCAGCTTGAGGGTGG - Intronic
988350869 5:30106066-30106088 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
989074792 5:37552764-37552786 CTGTGCATTCAGCTCAAGGCTGG - Intronic
995466261 5:112452187-112452209 CAGGGCATGCACTGTGAGGCTGG - Intergenic
1004780281 6:18901000-18901022 CTGGTCATTCAGCTAGAAGCCGG - Intergenic
1006399960 6:33811828-33811850 CAAGGCAGTCAGCTTGTGACAGG + Intergenic
1006441952 6:34058585-34058607 GAGGGGATTCAGGGTGAGGCAGG + Intronic
1006950761 6:37819757-37819779 CAGGCCGGTCAGCTGGAGGCGGG - Exonic
1007362287 6:41367644-41367666 CAGGGCATTCAGCGTTTGGTGGG + Intergenic
1009375778 6:62966527-62966549 CAGGGCATACTGCATGATGCTGG + Intergenic
1010054760 6:71552043-71552065 CTGGGCCCTCAGCTTGAAGCAGG - Intergenic
1010614821 6:77999834-77999856 CAGGGCCTTCAGCTTGCAGATGG + Intergenic
1011070756 6:83380227-83380249 GAGGGCATTCAACTTGGGGTAGG + Intronic
1013845499 6:114445604-114445626 CAGGACATACAGCTAAAGGCTGG + Intergenic
1015282754 6:131451488-131451510 CAGGGAATTCAGCATCATGCTGG + Intergenic
1015809221 6:137144660-137144682 CAGAGAACTCAGCTTGAAGCTGG - Exonic
1016183163 6:141171497-141171519 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1016769165 6:147829248-147829270 CACAGCAAACAGCTTGAGGCAGG - Intergenic
1017645067 6:156532764-156532786 CAGCGCCTGCACCTTGAGGCTGG - Intergenic
1019923963 7:4180276-4180298 CAGGGCATAGAGCTAGAGCCGGG - Intronic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1022345896 7:29514496-29514518 CAGGGCCTTAATCTTGAAGCAGG - Intergenic
1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG + Intronic
1023579873 7:41670378-41670400 CAGGGGTTTCAGTTTGATGCTGG - Intergenic
1024178546 7:46864378-46864400 GAGGGCATTCAGCTGGGGGAGGG - Intergenic
1026893262 7:73995542-73995564 CAGGGCTTTGAGCCTGAGGCAGG + Intergenic
1027422096 7:78026730-78026752 CAGGGCATCCAGCTTCAGGCTGG + Intronic
1027641407 7:80737800-80737822 GAAGGAATTCAGCTTGAGGAAGG + Intergenic
1030538547 7:110800325-110800347 CATGCCATTCAGCTTTGGGCGGG - Intronic
1030789506 7:113706467-113706489 CAGGGCATTCAGAGTGAGTAGGG - Intergenic
1033291814 7:140091511-140091533 CAGAGGATTGAGCCTGAGGCAGG - Intronic
1034452055 7:151142424-151142446 CAGGGCACCCAGGTTCAGGCTGG - Exonic
1034520522 7:151615907-151615929 CAGGGCATTTGGCTTGCAGCAGG - Intronic
1034711185 7:153192868-153192890 CATGACATTCACCTTGAGGAAGG - Intergenic
1034843562 7:154422228-154422250 CAAGGAAATCAGGTTGAGGCTGG + Intronic
1035100784 7:156394691-156394713 GGGGGCATCCAGCTCGAGGCTGG + Intergenic
1035595171 8:851971-851993 CAGGGCACTCAGCTAGTGGGCGG + Intergenic
1037105944 8:15108356-15108378 CAGGACATTCAGCGAGAAGCAGG - Intronic
1038384455 8:27129039-27129061 GAGGGCATTTATCTTGAGGTTGG + Intergenic
1039839033 8:41280468-41280490 CAGGGCATTCAGCTTGAGGCCGG - Intronic
1047115083 8:121832916-121832938 CAGGGCAGGCAGCTTGAGCTGGG + Intergenic
1047761835 8:127960279-127960301 CAGGTCACACAGCTTGAGGGTGG + Intergenic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049545859 8:143230225-143230247 CAGGTCATGCACCTTCAGGCTGG + Intergenic
1049658910 8:143811024-143811046 CAGGGCCTTGAGATTGAGGTGGG + Exonic
1049818695 8:144621110-144621132 CAGGGCAGGCAGCTGCAGGCTGG - Intergenic
1051181823 9:14419486-14419508 CAGAGCATTCAACTAGACGCAGG - Intergenic
1051365962 9:16321660-16321682 CAGTGGATGCAGCTGGAGGCTGG - Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1055463629 9:76542588-76542610 CAGTGCATTCTGCTTTAGGCTGG + Intergenic
1057271587 9:93654620-93654642 CAGGGCAGTAAGCTTGATGAGGG - Intronic
1060658444 9:125388613-125388635 CAGGGCATTTGGCTAAAGGCTGG + Intergenic
1061876691 9:133547642-133547664 CGGGGCATTAAGGTTGAGGCTGG + Intronic
1187880166 X:23839371-23839393 CAGGGGAGTCTGCTTGAGGCTGG + Intronic
1196395953 X:115261776-115261798 CAGGCCTTTCAGCTTGAGGGTGG + Intergenic
1197335662 X:125206405-125206427 CAAGGTCTTCAGCTTCAGGCAGG + Intergenic
1198260224 X:134959401-134959423 CAGGGCATACAGTGTAAGGCTGG - Intergenic
1200091143 X:153636636-153636658 CAGGGCAGCCAGCTTGAGACTGG - Intergenic
1200394931 X:155979444-155979466 CAGGGCAGGCAGCTTGGGGTGGG - Intergenic