ID: 1039839200

View in Genome Browser
Species Human (GRCh38)
Location 8:41281363-41281385
Sequence CCCCCATGCTGAGGGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039839200_1039839207 3 Left 1039839200 8:41281363-41281385 CCCTCACTCCCTCAGCATGGGGG 0: 1
1: 0
2: 3
3: 26
4: 262
Right 1039839207 8:41281389-41281411 TGATGTTGCAGCCACAGACAGGG No data
1039839200_1039839206 2 Left 1039839200 8:41281363-41281385 CCCTCACTCCCTCAGCATGGGGG 0: 1
1: 0
2: 3
3: 26
4: 262
Right 1039839206 8:41281388-41281410 TTGATGTTGCAGCCACAGACAGG No data
1039839200_1039839208 4 Left 1039839200 8:41281363-41281385 CCCTCACTCCCTCAGCATGGGGG 0: 1
1: 0
2: 3
3: 26
4: 262
Right 1039839208 8:41281390-41281412 GATGTTGCAGCCACAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039839200 Original CRISPR CCCCCATGCTGAGGGAGTGA GGG (reversed) Intronic
900188266 1:1342930-1342952 GCCCCATGCTGGGGGGGTGGGGG - Intronic
900188294 1:1343027-1343049 TCCCCATGCTGGGGGGGTGGGGG - Intronic
900472951 1:2863561-2863583 CCCCAAGGCTAAGGGACTGAAGG - Intergenic
900655520 1:3754936-3754958 CCCTCTTGCTGAGGCAGTGGGGG - Intronic
900946511 1:5834126-5834148 CGTCCATGCCGAGGGAGTGAAGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902613449 1:17610366-17610388 CCCCCAGCCTGAGAGTGTGAGGG - Intronic
902748240 1:18487885-18487907 CCTCTATGCTGAGGCAGTGGAGG + Intergenic
902750439 1:18505442-18505464 CCTCCCTGCTTAGGGAGGGAAGG - Intergenic
903864733 1:26389798-26389820 CCCACAGGCTGAGGGAAGGAGGG + Intergenic
904494415 1:30878590-30878612 CCCCCAGGCAGAGGTAGGGAGGG + Intronic
905263644 1:36736341-36736363 GCCCCAAGGAGAGGGAGTGATGG - Intergenic
905519901 1:38589614-38589636 CCTCTATGCTGGGGGAGTGGAGG - Intergenic
906690220 1:47787664-47787686 CCCCCATGGTGGGAGACTGAGGG - Intronic
907314456 1:53559570-53559592 GCCGCATGGTGAGTGAGTGATGG - Intronic
910108711 1:83659134-83659156 CCCCTATGCTGTTGCAGTGATGG - Intergenic
910414195 1:86981197-86981219 CCCACATGTTGAGGGAGCAAGGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913531568 1:119737564-119737586 TCCACATGCCGTGGGAGTGAAGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915797422 1:158751938-158751960 CCCCCAGGCTGTAGGTGTGAAGG + Intergenic
916097656 1:161365426-161365448 CCCCCATGCTGGGATAGTGGTGG + Exonic
916234183 1:162569263-162569285 CCCCCATTCTGAGGAGGTGGGGG - Intronic
917474974 1:175361734-175361756 CCCACGTGCTGTGGGAATGATGG + Intronic
1063598302 10:7457500-7457522 CCCACATGCTCAGGGAGAGAAGG - Intergenic
1069904982 10:71726867-71726889 CCACAATGCTGAGGCACTGATGG - Intronic
1070749685 10:78956589-78956611 AGCCCATGCTGGGGAAGTGAGGG - Intergenic
1071600612 10:86957097-86957119 GCCCCATGCTGGGTGATTGATGG + Intronic
1072019557 10:91384401-91384423 TCTCCATGCTGTGGGAGTGTGGG + Intergenic
1074686447 10:115966365-115966387 CCCACGTGTTGAGGGAGGGAGGG + Intergenic
1075699365 10:124459112-124459134 GCCACATGCTGAGAGAGTGGTGG + Intergenic
1076196029 10:128519008-128519030 CCCCTCTGCTGAGGCAGGGAAGG + Intergenic
1076252930 10:128997474-128997496 CCCCCATCCTTAGGGACTCAGGG + Intergenic
1076443787 10:130498159-130498181 CCTCCTTGGTGAGGTAGTGATGG + Intergenic
1076940460 10:133603521-133603543 ACACCATGCTGCTGGAGTGAAGG - Intergenic
1077044378 11:537926-537948 CCCCCATGGTGAAGGGGCGAGGG + Intronic
1077580409 11:3413731-3413753 CCCGCATGGTGTGGGAGTGTGGG + Intergenic
1078568737 11:12439518-12439540 CCCCCATTCTTTGGGAATGATGG + Intronic
1079419892 11:20276259-20276281 CTCCAGTGGTGAGGGAGTGATGG - Intergenic
1079443255 11:20536121-20536143 CCCCCATCCTGGGGAAGAGATGG + Intergenic
1080223683 11:29935612-29935634 TCACCAGGCAGAGGGAGTGAGGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083153783 11:60810247-60810269 ACCCCACCCTGAGGGTGTGAGGG - Intergenic
1084237335 11:67796560-67796582 CCCACATGGTGTGGGAGTGTGGG + Intergenic
1084330466 11:68426983-68427005 CCCCACTGCTGAGGCAGAGAGGG - Intronic
1084359523 11:68660559-68660581 CCCCCCAGCTGAGGGAGTTTGGG + Intergenic
1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG + Intronic
1084835067 11:71796268-71796290 CCCGCATGGTGTGGGAGTGTGGG - Intronic
1086534185 11:87824118-87824140 CCACCATGCTGGGGAAGGGATGG - Intergenic
1086835300 11:91613589-91613611 CCCACATGGCGAGGAAGTGAGGG + Intergenic
1089322136 11:117633614-117633636 CCCACATGCTGAAGGATTGAGGG - Intronic
1091175076 11:133550461-133550483 CCTTCATGAGGAGGGAGTGATGG + Intergenic
1095200455 12:39378507-39378529 CCACAAAACTGAGGGAGTGAGGG + Intronic
1095554111 12:43480788-43480810 TCCACATGCTGAGGGAGTGTGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096799348 12:54099349-54099371 GCCCCTGGCTGAGGGAGTGGTGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098079432 12:66768535-66768557 CCAGCAGGCTGAAGGAGTGAAGG + Intronic
1098394307 12:70002440-70002462 CCCCCATGCTCAGTGGCTGAGGG - Intergenic
1099467495 12:83005535-83005557 TCCCCATGCTCTGAGAGTGACGG + Intronic
1099985693 12:89660514-89660536 CACACATGCTTTGGGAGTGAGGG - Intronic
1101332626 12:103769334-103769356 ACCCCATGCTGAGGGCCTGCTGG - Intergenic
1101337441 12:103808934-103808956 CCTTCATGCTGATGTAGTGAGGG - Intronic
1101730878 12:107426034-107426056 CCCCCTTGCTGGGGGTGGGAGGG - Intronic
1101998578 12:109542514-109542536 GCCACATGCTGAGGTAGTGGGGG - Intergenic
1103340051 12:120216359-120216381 GCCCCATGATGAGGGGGTGCAGG - Intronic
1103406615 12:120680427-120680449 CCTCCATCCTGAGAGAGTGCTGG + Intergenic
1103415340 12:120739060-120739082 CTCCCCTGCTGAGGGAGTGGGGG + Intronic
1104706314 12:130950144-130950166 CCCAAATGCTGAGGGAGAGCTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108566587 13:51705109-51705131 CCCACGTGCTGAGGAACTGAGGG + Intronic
1110596692 13:77327173-77327195 CCCCGAGGCGGAGGGAGTGGTGG - Intergenic
1111597254 13:90427795-90427817 CCCACAAGCTCAGGGAGGGAGGG + Intergenic
1111899216 13:94180560-94180582 GCTACATGCAGAGGGAGTGACGG + Intronic
1113778520 13:112962708-112962730 CCCCCAGGCTCTGGGAGGGAAGG + Intronic
1117079016 14:52132577-52132599 CACCCATGGTGAGGAAGTGGAGG + Intergenic
1118438064 14:65789481-65789503 CCCCCTTGCTGTGGCAGTGCTGG + Intergenic
1118699226 14:68416825-68416847 GACCCAGGCTGAGGGAGAGAAGG + Intronic
1119410563 14:74427422-74427444 CCCACATCCTGTGGGAGTGAAGG - Intergenic
1119436265 14:74599811-74599833 TGCCCATGCTCAGGGAGTGCTGG - Intronic
1119512367 14:75221544-75221566 TCCCCATGCTGAGGGTTTCAGGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120847568 14:89139474-89139496 CTCCCAGGCCCAGGGAGTGATGG + Intronic
1121728173 14:96167970-96167992 CAGCCTTGCTGAGGGATTGATGG - Intergenic
1122695107 14:103548621-103548643 CACCCATGTTGGGGGAGTCAGGG - Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123476006 15:20592937-20592959 CCCTCAGGCTGGAGGAGTGATGG - Intergenic
1123642005 15:22407426-22407448 CCCTCAGGCTGGAGGAGTGATGG + Intergenic
1124354382 15:28984222-28984244 GGGCCATGCTGGGGGAGTGAGGG + Intronic
1125031235 15:35078258-35078280 CCAGCCTCCTGAGGGAGTGAGGG + Intergenic
1125035161 15:35115300-35115322 CCCCCAGCCTGAGAGAGTGCAGG + Intergenic
1125556395 15:40588954-40588976 ATCCCAAGCTGAGGTAGTGATGG - Intergenic
1125933570 15:43616590-43616612 CGCCCGTGCTCAGGCAGTGAAGG + Exonic
1125946668 15:43716052-43716074 CGCCCGTGCTCAGGCAGTGAAGG + Intergenic
1127259792 15:57319536-57319558 CTCCCCTGCGGAGGGAGGGAAGG - Intergenic
1127628862 15:60806690-60806712 CCAACATGCTGAGTGAGTTAAGG + Intronic
1127931419 15:63599901-63599923 CCCCCACGCAGAGGAAATGAAGG + Intronic
1128292441 15:66488235-66488257 CCCCACTGCTGAGGGAATCAAGG - Intronic
1129616284 15:77100984-77101006 GCCCCTTGCTGAGGGAGGGAGGG + Exonic
1131343650 15:91626694-91626716 CCCCTTAGCTGAGGGAGTCATGG - Intergenic
1131515522 15:93073832-93073854 CCCCCGTGCTGAGGGCCTGCGGG + Exonic
1132294689 15:100726477-100726499 GCCCCATGGTGAGTCAGTGAGGG - Intergenic
1132679321 16:1133270-1133292 CCCCCAGGTGAAGGGAGTGAGGG + Intergenic
1133348951 16:5088983-5089005 CCCCCATGGTGTGGGAGTGTGGG + Intronic
1133386108 16:5371675-5371697 CCCACATTTTGAGGGAATGAAGG + Intergenic
1133691558 16:8220579-8220601 CCCCCATGCTGTGCTTGTGATGG + Intergenic
1133908098 16:10039722-10039744 CCTCATTGCTGAGGGAGGGAGGG - Intronic
1133919202 16:10137100-10137122 CCCACCTGCAGGGGGAGTGAAGG - Intronic
1136750091 16:32627468-32627490 CCCACATGCTGAGGGTGTGATGG + Intergenic
1137290738 16:47050365-47050387 CCCACCTGCTGGGGGAGGGAGGG - Intergenic
1137675368 16:50301300-50301322 CCCCCATGTGGAGGGAGAGGTGG + Intronic
1138319050 16:56095304-56095326 CCCCTAACCTGTGGGAGTGAAGG - Intergenic
1138356644 16:56386419-56386441 CTCCCAGGCTGAGCGTGTGAGGG - Intronic
1138506991 16:57483297-57483319 CCCCCAAGCTGAGCCTGTGAAGG + Intronic
1139016429 16:62694985-62695007 CCCACCTGCTGAGGGAGCCAAGG + Intergenic
1140905736 16:79407473-79407495 CACACATGCAGAGGGAGAGAGGG - Intergenic
1141402588 16:83763472-83763494 CCCCCAAACTGAGGGTGGGAGGG + Intronic
1203052219 16_KI270728v1_random:886667-886689 CCCACATGCTGAGGGTGTGATGG + Intergenic
1143651579 17:8266891-8266913 ACGCCATGGTGAGGAAGTGAGGG + Exonic
1143889064 17:10088428-10088450 CCTCCAGGCTGAGGCAATGAGGG + Intronic
1144074031 17:11701031-11701053 CACTCAGTCTGAGGGAGTGAAGG - Intronic
1144281889 17:13734549-13734571 CCCACATGTTGTGGGAGGGACGG + Intergenic
1144434145 17:15224089-15224111 CCCCTTTTCTGGGGGAGTGAAGG + Intergenic
1144636026 17:16909667-16909689 GCCCTATGCTGAGGAAGGGATGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146067059 17:29644292-29644314 GCCCCGTGCTGAGGGAGCTAGGG - Intronic
1148108731 17:45132725-45132747 CCCCCATGCTGCGGGGCTGGGGG + Intronic
1148685518 17:49498378-49498400 CCCCTATCCAAAGGGAGTGAGGG + Intronic
1149073739 17:52574492-52574514 GCCACATCCTGAGGGAGGGAAGG - Intergenic
1149077012 17:52607654-52607676 CCCACATGTTGAGGGAGGGAGGG + Intergenic
1150212341 17:63447996-63448018 CCCCCATGCAGCGGGTGTGCAGG - Intergenic
1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG + Exonic
1151324852 17:73373027-73373049 GCCAGAGGCTGAGGGAGTGAGGG - Intronic
1152040731 17:77901002-77901024 CCCCCATACTGAGAGGGTGCTGG + Intergenic
1152681835 17:81672480-81672502 CTGCCAGGCTGAGGGAGAGAGGG - Exonic
1152910750 17:83003708-83003730 CCCACATGCGGAGGGCGGGAGGG - Intronic
1152910821 17:83003988-83004010 CCCACATGCGGAGGGCGGGAGGG - Intronic
1155288725 18:24319467-24319489 CTCACAAGCTGAGGGTGTGATGG + Intronic
1158297077 18:56010149-56010171 CCCACATGCTGTGGGAGGGACGG - Intergenic
1158510374 18:58085136-58085158 GTCCCATTCTGAGGTAGTGAAGG + Intronic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1161352756 19:3803127-3803149 CCGCGATGCTGACGGAGAGAGGG + Intergenic
1162095571 19:8307955-8307977 ACCCCATGCTGGGGGAGGGGAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164517648 19:28949721-28949743 GCCCTCTGCTGAGTGAGTGATGG + Intergenic
1164821826 19:31256685-31256707 CCTCCATTCAGAGGAAGTGACGG + Intergenic
1165764984 19:38344594-38344616 CCTCCATGCTGAGGGACTATGGG - Intronic
1166315310 19:41986026-41986048 CCCCCAGGCAGAGGGAGTCTGGG - Intronic
1166669539 19:44701556-44701578 CCCCCAGTCTGAGAGAGGGAAGG + Intronic
925210897 2:2045088-2045110 CCCCCACACTGAAGGAATGAAGG + Intronic
925876182 2:8312903-8312925 CCCGCCTGCTGAGGGAGAGCAGG + Intergenic
927714513 2:25342928-25342950 CCCCCACGGTGAAGGGGTGAGGG - Intergenic
929897048 2:45969645-45969667 CCCTCATGCTGCAGGAGTGGGGG - Intronic
930594068 2:53364372-53364394 CCCACATGTTGAGGGAGGGGAGG - Intergenic
931263226 2:60638291-60638313 CCCCCAGGCTGAGGGGGCCAGGG + Intergenic
935697228 2:105780769-105780791 CTCACATGCTGAAGGGGTGAGGG - Intronic
937150412 2:119682305-119682327 CCACCAGGCTGTGGGAGTCAGGG + Intronic
937782412 2:125854230-125854252 ACCCCATACTGGGGGAATGAAGG - Intergenic
937956096 2:127422552-127422574 CCCGCAGGCAGAGGGAGTGATGG + Intronic
939084882 2:137707582-137707604 CTCCCAGACTGTGGGAGTGAAGG - Intergenic
946481401 2:220060268-220060290 CCCACATGCTGAGGGGCTGATGG - Intergenic
947874281 2:233458199-233458221 CCCCCAGAGGGAGGGAGTGAGGG + Intronic
947956757 2:234198890-234198912 CCACCATCCTGAGGAAGTGGTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948755941 2:240159591-240159613 CCCTGGTGCTGAGGGACTGAGGG - Intergenic
949021599 2:241743972-241743994 CCCCCATCCTGAGGGAGGCCTGG + Intronic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1169134742 20:3190564-3190586 CCACCATCCTGGGGAAGTGATGG - Exonic
1171031076 20:21676843-21676865 CGCCCATGCTGAGGAGATGAGGG - Intergenic
1174960212 20:55147859-55147881 ACACCATGCTGGGGGAGAGAGGG - Intergenic
1175768289 20:61606299-61606321 CCCCCATGCTGTGGAAGGAATGG - Intronic
1176214021 20:63939748-63939770 CTCCCATGGGGAGGGAGGGAGGG - Intergenic
1176382996 21:6122726-6122748 CCCCAGTGCTGAGGGAGCGAAGG - Exonic
1177231531 21:18327054-18327076 CCCCAAAGCTGAGGGATTAAGGG - Intronic
1179176732 21:39013350-39013372 CCCCAGTGCACAGGGAGTGAGGG + Intergenic
1179740473 21:43415513-43415535 CCCCAGTGCTGAGGGAGCGAAGG + Exonic
1181023223 22:20114085-20114107 CCCCCTTGCTGGGGCAGGGAAGG - Intronic
1182043883 22:27259450-27259472 CCTCCAGGCTGGGGGAGCGATGG - Intergenic
1182272345 22:29163096-29163118 CCCACGTGTTGAGGGAGGGAAGG + Intronic
1182698127 22:32209924-32209946 TGCCCATGGTGAGGGGGTGAGGG - Intergenic
1183983755 22:41557927-41557949 CCCCCATGTTGTTTGAGTGATGG - Intergenic
1184180681 22:42822569-42822591 CCCCCATGCTGAGGGACTCCTGG - Intronic
1185049688 22:48547476-48547498 CCCCCATACTGGGTGAGAGATGG + Intronic
950137027 3:10588695-10588717 CTCCCTTGCTGAGTGATTGACGG + Intronic
952419533 3:33118737-33118759 CCCCCATGCTGATGGACTCTTGG - Intronic
956128054 3:66029585-66029607 GCCCCATGCTGAGTGTGTCATGG - Intronic
957053281 3:75426326-75426348 CCCGCATGATGTGGGAGTGTGGG + Intergenic
960439300 3:117667079-117667101 ACTGCATGCTGAGGGAGGGAGGG - Intergenic
960492212 3:118331888-118331910 CCCCAATGTTGAGGGAGAAACGG + Intergenic
961301546 3:125925217-125925239 CCCGCATGGTGTGGGAGTGTGGG - Intergenic
961769140 3:129235787-129235809 CTCACATGCTGTGGGACTGAGGG - Intergenic
961886924 3:130102640-130102662 CCCGCATGGTGTGGGAGTGTGGG + Intronic
962250008 3:133830263-133830285 CCACCATGCTGAGAGAGAGCTGG - Intronic
962668368 3:137679498-137679520 CCCCCTTTCCGGGGGAGTGAAGG - Intergenic
962736279 3:138328352-138328374 ACCCCATGCTGGGGGTGGGAGGG - Intronic
963294216 3:143527757-143527779 CCCCACTGCTGAGGCACTGAGGG - Intronic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
965698485 3:171435331-171435353 CCCCCATGCTGGGGAAGTGGAGG + Intronic
967020374 3:185517291-185517313 CCCCCATGGTGAGGGCCTGCAGG + Intronic
967156199 3:186694810-186694832 CCCACATGGGGAGGGAGTGGAGG + Intergenic
967850771 3:194081045-194081067 CCCCCATGCTGAGGGCCAGGTGG - Intergenic
968088055 3:195883022-195883044 CCCCCAACCTGATGGAGTAAAGG - Intronic
968996082 4:3946644-3946666 CCCGCATGGTGTGGGAGTGTGGG + Intergenic
969059699 4:4424978-4425000 CCCACAAGCTGAGGGAGTTGTGG + Intronic
969743960 4:9055198-9055220 CCACCAAGCAGGGGGAGTGATGG - Intergenic
969817883 4:9699596-9699618 CCCGCATGGTGTGGGAGTGTGGG - Intergenic
970772046 4:19625385-19625407 CCCCCACGCTGTGAGAATGAGGG + Intergenic
974424474 4:61723426-61723448 CCCCCATACAGAGGGAGTGGGGG + Intronic
975643701 4:76525789-76525811 CATCCATGCTGAGGCAATGATGG - Intronic
977618625 4:99111540-99111562 CCCCCAAGGAGAGGAAGTGAAGG - Intergenic
979092407 4:116501924-116501946 GCCACATGCTGAGGTACTGAAGG - Intergenic
979950390 4:126885692-126885714 CTCCCATGCTGAGAGAGGGGTGG + Intergenic
980011878 4:127604989-127605011 ACCCCAGGATGAGGGAGAGAAGG + Intergenic
980244978 4:130227087-130227109 CTCCCATGCTACGGGAATGAAGG + Intergenic
981011979 4:139934542-139934564 CCCTCTTTCTGAGGGGGTGATGG - Intronic
981478084 4:145208525-145208547 CCCCCATTCTGAATGAATGATGG + Intergenic
982166437 4:152617735-152617757 CCCTGATGCTGTGGGAGTGTGGG + Intergenic
984708731 4:182867013-182867035 CCCCCATACTGAGCGAGCGCCGG - Intergenic
984905111 4:184619234-184619256 ACCCCATGCTGGAGAAGTGATGG - Intergenic
985520935 5:373690-373712 CCCCCAGGCTCAGGGAGGGCGGG + Intronic
985913710 5:2902160-2902182 GCCCCATCCTGAGAGAGAGAAGG + Intergenic
987292108 5:16519154-16519176 CCCCGCTGCTGAGGAAGAGATGG + Intronic
991601278 5:68353736-68353758 CCCCCATGCTGTTGGAGTGGGGG + Intergenic
994140574 5:96336355-96336377 CCTTCATGCTTAGGGAGAGAGGG + Intergenic
996785956 5:127236947-127236969 CCCCCAGATTTAGGGAGTGATGG + Intergenic
999277189 5:150339104-150339126 CCCCCAGGCAGAGGGAGAGGGGG - Intronic
1001991853 5:176123487-176123509 TCCACACGCTGAGGGTGTGATGG + Intronic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1002225020 5:177714665-177714687 TCCACACGCTGAGGGTGTGATGG - Intronic
1002434283 5:179221551-179221573 CCCCCATGCTGGGGGTGGAAGGG + Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004343130 6:14824967-14824989 CTCACATGCAAAGGGAGTGAAGG + Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005051952 6:21692936-21692958 CCCCTTTGCTGTGGGGGTGAGGG + Intergenic
1006364941 6:33609856-33609878 CCCCTAGACTGAGGGGGTGATGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG + Intergenic
1018915663 6:168131000-168131022 CCCCTGTGCTGGGGAAGTGAAGG + Intergenic
1019142165 6:169955860-169955882 CCTCCAGGGTGAGGGAGGGAGGG + Intergenic
1019552603 7:1610612-1610634 CGCCGATGATGAGGGAGGGAGGG + Intergenic
1020320355 7:6935054-6935076 CCCGCATGGTGTGGGAGTGTGGG + Intergenic
1022501682 7:30885896-30885918 CCACCATGATGGGGGATTGATGG - Intronic
1023362582 7:39431602-39431624 CCTCCATGCTGTGGGAGCTAGGG + Intronic
1024209918 7:47194380-47194402 GCCCCATTCTGAGGTAGTGGGGG - Intergenic
1028800556 7:94960368-94960390 CCTCTATGCTGAGGGAGGGAGGG + Intronic
1029069380 7:97882693-97882715 CCGCCAAGCAGGGGGAGTGATGG + Intergenic
1030092913 7:105873502-105873524 CCCCCATGGTGAGAAATTGAAGG - Intronic
1030597590 7:111558607-111558629 CCTCCATTTTGAGGTAGTGAGGG - Intronic
1032521665 7:132550201-132550223 CCACCATGCTGTGGGGGTCAGGG - Intronic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033554590 7:142477671-142477693 CCCCAATACTGTGGGATTGAAGG + Intergenic
1034227389 7:149494562-149494584 CCCCCGTGCCTAGGGAGAGAGGG - Intronic
1034242567 7:149621618-149621640 CCCCCGTGCCTAGGGAGAGAGGG - Intergenic
1034691870 7:153020507-153020529 CACCCACGCTGAGAGGGTGATGG - Intergenic
1034892296 7:154852129-154852151 CCACCATGCTGAGGGCTTCAGGG - Intronic
1034982422 7:155487632-155487654 CCCAGGTGCTGAGGGAGAGAGGG - Intronic
1035307659 7:157943569-157943591 CCTCCATGTTGAGGGAGTCTGGG - Intronic
1038840994 8:31184645-31184667 ACGCCTTGCTGAGAGAGTGAGGG + Intergenic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1041484425 8:58358967-58358989 ACCCCTTGCTAAGGGAGAGACGG + Intergenic
1042114211 8:65413859-65413881 CCACCAGGTTGAGGGACTGATGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043441991 8:80284416-80284438 CCCCCAGGCTTGGGGAGTTAAGG - Intergenic
1044609830 8:94080522-94080544 CCCCCGTGCTGATGGATTGATGG - Intergenic
1046115476 8:109778719-109778741 CCCCCAAGCAGAGGCAGTGTTGG + Intergenic
1046664721 8:116988163-116988185 CACCCATGCAGAGGGGATGATGG + Intronic
1049654520 8:143791828-143791850 CCCCCATGCCTCGGGGGTGAAGG + Intronic
1049820854 8:144632427-144632449 CCACCAGGCAGAGGCAGTGAGGG - Intergenic
1052830256 9:33209427-33209449 CCACTATGCCCAGGGAGTGAGGG + Intergenic
1056581269 9:87889315-87889337 CCCTCAGGCTGGAGGAGTGATGG + Intergenic
1056621852 9:88221351-88221373 CCCCCAGGCTGCGGGGGTGGGGG - Intergenic
1056998342 9:91484585-91484607 CCACCATGCTGAGGGTGTATGGG + Intergenic
1057887301 9:98839712-98839734 CCCGCCTGCTGATGGAGTGAAGG - Intronic
1058702881 9:107615179-107615201 CCCCCACGCAGAGGGAACGAAGG + Intergenic
1058704589 9:107627924-107627946 CCTCCCTGCTGAGGGAGGGCAGG + Intergenic
1060157122 9:121327538-121327560 CCCCCAAGCTGAAGGAAAGAAGG - Intronic
1062276833 9:135735373-135735395 CACCCATGCTGAGGGAGGGCTGG - Intronic
1062460932 9:136662315-136662337 GGCCCATGGTGAGGGGGTGACGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187241687 X:17519761-17519783 CCACCATCCTGAGGGACTTAGGG + Intronic
1187568690 X:20478475-20478497 GCTCCATGCTGAGGGAGTTCTGG - Intergenic
1188967434 X:36572128-36572150 ATTCCAGGCTGAGGGAGTGAAGG - Intergenic
1192543018 X:71990975-71990997 CCTGTTTGCTGAGGGAGTGAAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195282217 X:103347674-103347696 CGCCCTTTGTGAGGGAGTGAAGG - Intergenic
1198198148 X:134385803-134385825 AAACCATACTGAGGGAGTGAAGG - Intronic
1199522384 X:148750454-148750476 ACCTCATGCTGAGGGATGGAAGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201340714 Y:12930327-12930349 TCCACATGATGAGGGATTGAAGG + Intergenic