ID: 1039839543

View in Genome Browser
Species Human (GRCh38)
Location 8:41284156-41284178
Sequence AAGAATAATAAGAAAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039839539_1039839543 14 Left 1039839539 8:41284119-41284141 CCTCATCACTGAGTGAAGATGGG 0: 1
1: 0
2: 2
3: 22
4: 142
Right 1039839543 8:41284156-41284178 AAGAATAATAAGAAAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039839543 Original CRISPR AAGAATAATAAGAAAGAGTC TGG Intronic
No off target data available for this crispr