ID: 1039839694

View in Genome Browser
Species Human (GRCh38)
Location 8:41284916-41284938
Sequence GTGTCTGACCTGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039839694_1039839703 24 Left 1039839694 8:41284916-41284938 CCTTCTTCCCTCAGGTCAGACAC 0: 1
1: 0
2: 2
3: 30
4: 280
Right 1039839703 8:41284963-41284985 TGCACCGCAAGAGTAAGTGGAGG No data
1039839694_1039839702 21 Left 1039839694 8:41284916-41284938 CCTTCTTCCCTCAGGTCAGACAC 0: 1
1: 0
2: 2
3: 30
4: 280
Right 1039839702 8:41284960-41284982 AGATGCACCGCAAGAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039839694 Original CRISPR GTGTCTGACCTGAGGGAAGA AGG (reversed) Intronic
901277545 1:8004421-8004443 GTGTCTCACGTGATGGAAGCTGG - Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903699175 1:25233405-25233427 GAGGCTGGCCTCAGGGAAGAAGG - Intergenic
904260723 1:29286102-29286124 GTGTCTGGCCTCAGGCAAGGTGG - Intronic
904592964 1:31625470-31625492 GAGTCAGACCTGTGGGAGGAGGG + Intronic
906089383 1:43165555-43165577 GTGACAGACTTGAGGGAAGCTGG - Intronic
906320274 1:44811444-44811466 GTGTCTGAACTGTGAGGAGAGGG + Intronic
906346613 1:45019511-45019533 CTCTCTGACCTGGGGAAAGAAGG - Intronic
908362221 1:63380372-63380394 GTGGCTGAAGTGGGGGAAGAAGG + Intronic
908739926 1:67317044-67317066 GTGTCTGAACTGAGTTTAGATGG + Intronic
910088342 1:83431286-83431308 GGGTCTGGCAGGAGGGAAGAAGG - Intergenic
910835154 1:91501118-91501140 GTCTCTGGCCCGAGGGAAGCCGG + Exonic
911069424 1:93820765-93820787 TCGTCTGACCTCTGGGAAGAGGG - Intronic
911370539 1:96989592-96989614 GTTTCTGACCAAAGGGAAGGAGG - Intergenic
912098716 1:106179248-106179270 TTATCTCAGCTGAGGGAAGAAGG - Intergenic
913327316 1:117638234-117638256 GTGCCTCACCTGAGGCTAGAAGG - Intergenic
914915877 1:151818915-151818937 AAGTCTGGCCTGAGGGATGATGG - Intronic
915290364 1:154879178-154879200 GTGGCTGTGCTGAGGGGAGAGGG - Intergenic
915680858 1:157580994-157581016 GAGGCTGACCTGAGGAGAGAGGG + Intronic
915885240 1:159714684-159714706 GTGTCAGAGCTTCGGGAAGAGGG + Intergenic
917218939 1:172706798-172706820 GTGTGTGACTTGGGGGAAGGAGG - Intergenic
918045070 1:180936500-180936522 GTGCCTGACCTGAGGGCGGCTGG - Exonic
918108272 1:181432024-181432046 GTGGCAGACCTGAGGGCAAAAGG + Intronic
918775633 1:188626364-188626386 ATGTCTGAACTGACAGAAGAAGG + Intergenic
919837503 1:201585137-201585159 GTGCCTGACTTCAGGGATGAGGG - Intergenic
919927961 1:202202265-202202287 ATGTGTGCCCTGAGGGAAAAAGG - Intronic
920016646 1:202916295-202916317 GTGACTGTTCTGAGGGAAAATGG - Intronic
920180518 1:204129455-204129477 GTGTCTCAGCAGAGGGAATAAGG - Intergenic
922878532 1:228960825-228960847 GCCTCTGACCAGAGGGGAGAGGG + Intergenic
923685291 1:236149259-236149281 GTGCCTGACATGAGAGCAGAAGG + Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924814211 1:247428098-247428120 GAGTCTGTCCTGAGGAAGGAAGG - Intronic
1062884926 10:1009203-1009225 CTCTTTGGCCTGAGGGAAGATGG + Intronic
1062992653 10:1834814-1834836 GTCACTGAGCCGAGGGAAGAGGG + Intergenic
1063611021 10:7562041-7562063 CTATCTGACATGAGGGAAGCTGG + Exonic
1063937961 10:11098399-11098421 GTGCCTGACCTAAGGGCAAATGG - Intronic
1064096368 10:12427335-12427357 GTGGCTGCCCAGAGGGAAGTGGG + Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066135639 10:32443089-32443111 GTCTCTGAGTTGAGGGAAGGAGG - Intergenic
1066696551 10:38084240-38084262 GTGAGTGACCTGAGTGAACAAGG + Intergenic
1067303662 10:45037701-45037723 GGGGCTTACCAGAGGGAAGAGGG + Intergenic
1071167525 10:82823717-82823739 TTGTCTGAGATGAGGGAAGAGGG - Intronic
1073284832 10:102381349-102381371 GTCTGTGAGCCGAGGGAAGAAGG + Intronic
1073452090 10:103616077-103616099 TAGTCTGACCTGATGGAACATGG - Intronic
1074533095 10:114310435-114310457 CTGGATGACCTGAGGCAAGAGGG + Exonic
1074778022 10:116780214-116780236 GTGTCTTCCCTGTAGGAAGAGGG + Intergenic
1076599144 10:131645869-131645891 GTGTGTGCCTTGAGGGGAGAGGG + Intergenic
1076635157 10:131876773-131876795 GGGTCTGCCCGGAGGGAGGAGGG + Intergenic
1076734027 10:132450843-132450865 GTGGCTGACGTGAGGGCAGGGGG - Intergenic
1077374829 11:2200611-2200633 GTGTCTGCTTTGTGGGAAGAGGG - Intergenic
1077463928 11:2724525-2724547 GTGGCTGCACTGAGGGCAGAAGG + Intronic
1077517829 11:3012564-3012586 GTGTCTGACCTGAGGAAAGCAGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1077982503 11:7314867-7314889 GTGTCTGAGCTGAATAAAGACGG - Intronic
1077991269 11:7414456-7414478 GTGTCTGCCCTTACTGAAGAGGG - Intronic
1078433515 11:11305762-11305784 GTGTCTGCCCTCAGGGAACTTGG - Intronic
1081613501 11:44577380-44577402 AAGTCTTCCCTGAGGGAAGAAGG - Intronic
1081702141 11:45158799-45158821 GTGTCTGTCCTTAGAGAAGGGGG - Intronic
1083063559 11:59899626-59899648 GTGTCAGCCCTAAGTGAAGACGG + Intergenic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083628241 11:64082801-64082823 ATGTCTGAGCTGAGGGAAACAGG - Intronic
1083985252 11:66210438-66210460 GAGTCTCACCTGAAGGGAGAAGG - Exonic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1086064980 11:82734168-82734190 GTGCCTCTCCTGAGGCAAGAAGG + Intergenic
1086240650 11:84686186-84686208 ATGTCTGACCTTAGGCAAGCAGG - Intronic
1089202477 11:116732749-116732771 TAGTCACACCTGAGGGAAGAGGG + Intergenic
1090805985 11:130202520-130202542 GTGTCTGAACTGAGGGTTGAAGG + Intronic
1091162968 11:133442763-133442785 GTGTCTTTTTTGAGGGAAGAAGG + Intronic
1091306866 11:134541890-134541912 GTGTCTGACCAGAGCTGAGATGG - Intergenic
1091998674 12:5015863-5015885 CTGGCTCACCTGAGGGCAGAGGG - Intergenic
1092632859 12:10402599-10402621 GTGGCCTACCTGAGGGTAGAGGG + Intronic
1094435331 12:30414867-30414889 GTGTTTGAGATGAGTGAAGAAGG - Intergenic
1094534248 12:31306961-31306983 GTATCTTACTTGAGGGGAGAAGG - Intronic
1096997893 12:55850620-55850642 CTGTTTGACCTGGGGTAAGAGGG + Intergenic
1097022142 12:56027952-56027974 GTGTCTGTCCAGTGGGAGGAGGG + Intronic
1097930913 12:65184955-65184977 GTATCTGAATTGAGGGAATAGGG - Intronic
1103393655 12:120591701-120591723 GTGTCTGAGCTGAGGCCTGAAGG + Intergenic
1104025129 12:125020353-125020375 GTGTCTCACATGAAGGAACAAGG + Intronic
1104531304 12:129573331-129573353 GAGCCAGACCTGAGAGAAGAGGG + Intronic
1105686680 13:22790141-22790163 AAGTCTCACCTGAGGGCAGATGG + Intergenic
1106105175 13:26726637-26726659 GTGGCTGCCCTGAGGGCAGGAGG - Intergenic
1106285963 13:28318251-28318273 GTGACAGGCCTGAGGGAAGGGGG + Intronic
1106825310 13:33514294-33514316 GTGTCTGGCTTGTGGGAAGGAGG + Intergenic
1107885040 13:44868014-44868036 GAGTCAGCCCTGAGGGAGGAGGG - Intergenic
1109997941 13:70154342-70154364 CTTTATGACCTGAGGTAAGATGG - Intergenic
1113508992 13:110837074-110837096 GTGTCTGAACTGAAAAAAGAAGG + Intergenic
1114484945 14:23056877-23056899 GTGTCTGCTCTGAGGGAGGAGGG - Intronic
1115445529 14:33485247-33485269 GTGTCTCATCTTCGGGAAGATGG - Intronic
1115976843 14:39005763-39005785 GTGCCTGACTTCAGGGATGAGGG - Intergenic
1116621663 14:47211622-47211644 GTGTCTGCCTTTAGGGAAGAGGG - Intronic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1118840361 14:69505380-69505402 ATCTCTGACCTGAGTGCAGATGG - Intronic
1119098209 14:71854116-71854138 GTGTCTGAGCTGGGGGATGAGGG + Intergenic
1119155306 14:72404773-72404795 GTGCCTGAATTGAGGGAAGTGGG + Intronic
1119537952 14:75418354-75418376 AACTCTGACCTGTGGGAAGAAGG + Intergenic
1119888833 14:78167307-78167329 GTCCCTGAACTGAGTGAAGATGG + Intergenic
1121019319 14:90569457-90569479 TCATCTGACCTGAGGGAGGAGGG + Intronic
1121228498 14:92339429-92339451 GTGACAGTCCTGAGGGTAGATGG + Intronic
1121435829 14:93918799-93918821 ATGTCTTCCCTGAGGGAGGATGG - Intergenic
1122048403 14:99039324-99039346 GTATCTGCCCTGAGGAATGAGGG + Intergenic
1126670860 15:51113864-51113886 GTGGCTGATCTGAGGGAGGCTGG - Intergenic
1129343994 15:74905223-74905245 TTCACTGACCTGAGGGGAGACGG + Exonic
1131297681 15:91165654-91165676 GAGACAGACCTGAGGGAGGAAGG + Intronic
1132578440 16:674559-674581 GGCCCTGACCTGAGGGAAGCAGG + Intronic
1132604074 16:786369-786391 GTGTCCGGCCTGCGGGATGAGGG + Exonic
1134263964 16:12676714-12676736 ATGTCTGACCTGAGGCCTGAGGG + Intronic
1136186293 16:28590759-28590781 GTGTGTCTCCTGGGGGAAGAGGG - Exonic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137719770 16:50621290-50621312 GTGTCAGGCCAGAGGGCAGATGG - Intronic
1141221119 16:82070178-82070200 GTGTCTGAGCTGTGGGATGCAGG - Intronic
1141313953 16:82942486-82942508 GGATTTGACCTAAGGGAAGAGGG + Intronic
1141440954 16:84029286-84029308 GTGTCTGGGCTCAGGGAAGTGGG - Intronic
1142610796 17:1108536-1108558 GTCTCCGAGCTGAGGCAAGAGGG - Intronic
1143029819 17:3961680-3961702 GGGTCAGGCCTGAGGGCAGAAGG - Intronic
1143057951 17:4176414-4176436 GTGTTTGAGCTGAGAGAACAAGG - Intronic
1143326312 17:6100730-6100752 GTGTCACAACTGAGGGAATATGG - Intronic
1143497558 17:7321161-7321183 GTGTCTGAACTGGGGGAAGGAGG + Exonic
1144760079 17:17702154-17702176 CTGGCTGACATGAGGGGAGAGGG + Intronic
1145207913 17:20994510-20994532 GTGTCTGACTTGAGGTGAGAGGG - Intergenic
1147167710 17:38602211-38602233 GTGCCTGCCCCGAGGGAGGAAGG - Intronic
1147664897 17:42140421-42140443 GTGGGAGACCTGAGGGACGATGG + Intronic
1147950468 17:44104878-44104900 GTGTCTGCTTTGTGGGAAGAGGG - Intronic
1149310340 17:55386965-55386987 GTCTCTGCCCTCAGGGGAGAAGG - Intergenic
1150960266 17:69904822-69904844 GTGTATCACCTGAGGTCAGAAGG + Intergenic
1151560241 17:74866054-74866076 ATGCCAGACCTGGGGGAAGAGGG - Intronic
1152477389 17:80526991-80527013 GCCTCTGTCCTGAGGGGAGAAGG - Intergenic
1152755552 17:82085585-82085607 GTGGCTGCCCTGAGAGAAGGGGG - Exonic
1153358141 18:4161236-4161258 GTGTCTGTCCTGGGGAAAGGTGG - Intronic
1154100282 18:11466634-11466656 GGGTCTGACCTGAAGGGAGGTGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155990707 18:32276249-32276271 GTGTCTGTCCTGGGGGCTGATGG + Intronic
1157370820 18:47109701-47109723 GGGTCTGACCTGAAGCATGAAGG - Intronic
1157772193 18:50358932-50358954 GTGTGTGTCCTGATGGCAGAGGG + Intergenic
1158012784 18:52748259-52748281 GTGTCTGGACTGGGGGAACACGG + Intronic
1159354306 18:67317344-67317366 CTTTATGACGTGAGGGAAGAGGG - Intergenic
1159687304 18:71438402-71438424 GAGTAGGCCCTGAGGGAAGAAGG + Intergenic
1159794344 18:72823427-72823449 GTGAGGGACCTAAGGGAAGAGGG + Intronic
1160864878 19:1252110-1252132 GTGGCTGCCCTGGGGGAAGGGGG + Intronic
1160875026 19:1292925-1292947 GTGTCAGACGTGGGGGAAGGAGG + Intronic
1161430462 19:4229406-4229428 GAGTCAGACCTGAAGGAAGTCGG + Intergenic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1163700036 19:18782363-18782385 GTGTCACCCCTGAGGGAGGAGGG - Intergenic
1165486735 19:36101049-36101071 GGGCCTGACCTGGGGGAAGGAGG + Intronic
1165719956 19:38072110-38072132 CTGTCTGACTTGAGGTAAGAAGG + Intronic
1166275730 19:41752532-41752554 TTGTCTGGCCTGTGGGAAGATGG - Intronic
1166339517 19:42129339-42129361 GTGTCTGACCTGAGGAAGGTGGG - Intronic
1166558280 19:43716064-43716086 GTGTCTGACCTTGGCTAAGAGGG + Exonic
1166783206 19:45352899-45352921 GTGTCTGAGTTGGGGGGAGAGGG + Intronic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168181674 19:54666226-54666248 GTCTCTGGGCTGGGGGAAGATGG - Exonic
925439358 2:3870536-3870558 TTGTCAGAGCTGAGAGAAGAAGG - Intergenic
925922500 2:8646977-8646999 GGGTCTGCCCTGAGTCAAGATGG + Intergenic
925924524 2:8660486-8660508 GTGACTGTCCACAGGGAAGAGGG + Intergenic
927855485 2:26525054-26525076 GTATCTCACCCCAGGGAAGAAGG + Intronic
927886524 2:26721811-26721833 ATGTTTGTCCTGAGGGAAGGTGG - Intronic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928446759 2:31339713-31339735 GTATCTGTCCTCAGGGAAGAAGG - Intronic
929878678 2:45818030-45818052 GAGTATGACCTGAGACAAGAGGG + Intronic
930092876 2:47544135-47544157 GTGTCTGACGTCAGGGTGGAAGG - Intronic
931944351 2:67288414-67288436 GTGTCTGTGCTTGGGGAAGAAGG + Intergenic
932074573 2:68651050-68651072 GAGTCAGACCTGAGGGCAGGAGG + Intronic
933876439 2:86624935-86624957 GTGTCAGTCTTGAGGGAGGAAGG + Intronic
934038555 2:88108866-88108888 GTGTGTCACCTGATGAAAGAGGG + Intronic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
936151781 2:110025757-110025779 GAGTCAGGCCTGAGGCAAGAAGG - Intergenic
936192893 2:110345612-110345634 GAGTCAGGCCTGAGGCAAGAAGG + Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938065682 2:128280855-128280877 GTGTGTGTCCTGAGGCAAGAGGG - Intronic
942142159 2:172988195-172988217 GTGTTTAACCAGGGGGAAGAAGG + Exonic
944507654 2:200429414-200429436 GATTCTGACCTGATCGAAGAAGG + Intronic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
944670639 2:201991658-201991680 GTGTCAGACCAGAAGGCAGATGG + Intergenic
946394033 2:219434548-219434570 GGGTCTGAGATGAGGGAGGAAGG + Intergenic
948315654 2:237026643-237026665 GGGACTCACCTGAGTGAAGAAGG + Intergenic
948794119 2:240393472-240393494 GTGTCCTGCCTGAGGGAAGTAGG - Intergenic
1169073661 20:2749233-2749255 GTGTCTGAGCTGGTGGAAGGGGG - Intronic
1172962838 20:38810595-38810617 GTTTCTCACCTGAGAGAAGAGGG + Intronic
1172969999 20:38866283-38866305 GTGTCTGTGCAGCGGGAAGAAGG + Intronic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1175582886 20:60114014-60114036 GTGCCTGACCGGATGGCAGATGG + Intergenic
1176146753 20:63568874-63568896 GTGTCTGGCATCAGGGAGGAGGG + Exonic
1176199397 20:63853756-63853778 GTGGATGACCTGAGTGGAGACGG - Intergenic
1178279329 21:31267249-31267271 GTCTCTGCCCAGAGAGAAGATGG + Intronic
1179475548 21:41641171-41641193 GTGTCTGACCTGAGATAAGGAGG + Intergenic
1179609731 21:42542361-42542383 GAGACTGACCTGTGGGAAGCAGG - Intronic
1180130380 21:45823209-45823231 GTGACTGACCTGAGGGGTCATGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181340063 22:22171664-22171686 GTTTCTGAACTGGTGGAAGATGG + Intergenic
1181644954 22:24226112-24226134 GTGTCTGTGCTGGGGGAGGATGG - Exonic
1182510399 22:30815614-30815636 GTGTATGTCCTGAGGGGAGATGG - Intronic
1184372894 22:44093927-44093949 GTGAGTGACCTGCAGGAAGAAGG + Exonic
1184538377 22:45103165-45103187 CTGCCTGACCTGGGGGAAGCAGG - Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
953738716 3:45518059-45518081 GTTTCTGACCTGAGAGATGACGG - Exonic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954245154 3:49325644-49325666 GTGGCTGATGGGAGGGAAGAGGG - Intronic
954318466 3:49814084-49814106 GTGTCAGACCTGAGGGTGGGAGG + Intergenic
954438542 3:50509002-50509024 GTGCCTGCCCCCAGGGAAGAGGG - Intergenic
954491726 3:50913056-50913078 GTGTCTCACCTGAAGGCAGCAGG + Intronic
954565261 3:51594604-51594626 GTTTCTGCTTTGAGGGAAGAAGG + Intronic
955252361 3:57297101-57297123 GTGTTTGACGTCAGGGAAGAGGG - Intronic
955396219 3:58559649-58559671 GTGACTGACTTGGGGGCAGAGGG + Intergenic
956904884 3:73755558-73755580 GTGTCAGACCTGACCTAAGATGG - Intergenic
958459231 3:94373328-94373350 GTGACTTCCCTGTGGGAAGAAGG + Intergenic
959112304 3:102136096-102136118 GAGACTGGCCTCAGGGAAGAGGG - Intronic
959275231 3:104269656-104269678 GTGGCTGCTGTGAGGGAAGAAGG + Intergenic
959782261 3:110248328-110248350 GTGTCTAATCTAAGGAAAGAGGG - Intergenic
961053116 3:123764343-123764365 GTGTCAGACCTCATGGTAGAGGG + Intronic
962270629 3:133975533-133975555 GGGTTTGAGCTGAGGGAACATGG - Intronic
965927140 3:173995548-173995570 CTTTCTGCCCTGAGTGAAGAGGG + Intronic
966643068 3:182211764-182211786 GTGTGTGACCTTAGGCAAGCTGG + Intergenic
968296593 3:197581570-197581592 GTGGCTGACCCCAGGAAAGATGG - Intergenic
968296601 3:197581605-197581627 GTGGCTGACCCCAGGAAAGATGG - Intergenic
968296642 3:197581780-197581802 GTGGCTGACCCCAGGAAAGATGG - Intergenic
968296650 3:197581815-197581837 GTGGCTGACCCCAGGAAAGATGG - Intergenic
968296690 3:197581990-197582012 GTGGCTGACCCCAGGAAAGATGG - Intergenic
968451823 4:679523-679545 GCCTCTGACCTGAGGCAGGAGGG + Intronic
970025917 4:11623950-11623972 GTGTCTGTCCTGTGGGAATTAGG + Intergenic
970245695 4:14059986-14060008 GTGTCTTACATGATGGAAGTAGG - Intergenic
970600096 4:17635163-17635185 GGGTTTGACTTGAAGGAAGATGG + Intronic
971498413 4:27292414-27292436 ATGTCTCCTCTGAGGGAAGATGG + Intergenic
974514241 4:62887793-62887815 GGGGCTTACTTGAGGGAAGAAGG + Intergenic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
975591392 4:76003691-76003713 TTGGCTGACCTGTGAGAAGAAGG + Exonic
978288216 4:107104315-107104337 GTGTTAGTCCTGAGGTAAGATGG + Intronic
984211106 4:176849668-176849690 GTCTCTGATCTGAGGGCATATGG + Intergenic
984582078 4:181521726-181521748 ATGACTGACATGTGGGAAGAAGG - Intergenic
984948186 4:184986285-184986307 GGGCCAGACCTGGGGGAAGAAGG - Intergenic
986650253 5:9956332-9956354 GTGGCTGACTTGTGGGCAGATGG - Intergenic
986730404 5:10631168-10631190 ATGGCTGGCCTCAGGGAAGAAGG + Intronic
986913543 5:12587497-12587519 GTGTCAGGACTGAGGGTAGAAGG - Intergenic
988599506 5:32626385-32626407 ATGTCTGTCATGTGGGAAGAAGG - Intergenic
990996313 5:61735518-61735540 GGGTCTGATCTGCTGGAAGAGGG + Intronic
994094397 5:95835845-95835867 GGGGCTGACCTCAGAGAAGAGGG + Intergenic
994223788 5:97228587-97228609 TTGACTGAGCTGGGGGAAGAAGG + Intergenic
996438438 5:123461418-123461440 ATGACTCACCTCAGGGAAGAGGG + Intergenic
997813335 5:136993411-136993433 GCGTATGCCCTGAGGGAAGAGGG - Intronic
999202236 5:149824686-149824708 GAGTCTGGCCTGAGGGTTGAAGG + Intronic
999511805 5:152260024-152260046 GTGTCTGAGCTGAGAGAAATGGG - Intergenic
999631885 5:153579991-153580013 GTATGTGACATGAGGGAAGAGGG - Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1000872538 5:166594910-166594932 TTGTGTGACCTTTGGGAAGAAGG + Intergenic
1004421651 6:15475847-15475869 GTTTCTGACTTGGGTGAAGAAGG + Intronic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1005530736 6:26702879-26702901 CTCTCTGACCTGATGGGAGAAGG - Intergenic
1005540060 6:26798767-26798789 CTCTCTGACCTGATGGGAGAAGG + Intergenic
1006847802 6:37074950-37074972 GTGCCTGCCCTGAAGGAAGACGG + Intergenic
1007900137 6:45403763-45403785 ATGTGTGACTTGGGGGAAGAGGG + Intronic
1009010877 6:57840900-57840922 CTCTCTGACCTGATGGGAGAAGG + Intergenic
1009511742 6:64559913-64559935 GGGTCCCACCTGAGGGTAGAGGG - Intronic
1013254435 6:108370464-108370486 TTGTCTCACCTGGTGGAAGAGGG + Intronic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013368071 6:109449595-109449617 GGGCCTGACCTGGGGGAAGGGGG + Intronic
1013657509 6:112260953-112260975 GAGTCTGAACTGATGGGAGAAGG + Intergenic
1017905957 6:158757680-158757702 GTGGCTGACCTGCTGGAAGCTGG + Intronic
1017945890 6:159095919-159095941 GGATCAGTCCTGAGGGAAGAGGG + Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018322362 6:162625018-162625040 GAGCCTTACCTGAGTGAAGAAGG - Intronic
1019405511 7:881828-881850 GGGGCCGGCCTGAGGGAAGAGGG - Intronic
1023305108 7:38817816-38817838 GTTTGTGACCGGAGGGAAGAAGG - Exonic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024331444 7:48159563-48159585 GTGGCTGACATCAGGGAAGATGG + Intergenic
1027305209 7:76887718-76887740 GGGTCTGGCAGGAGGGAAGAAGG - Intergenic
1029504626 7:100955341-100955363 GTGTCTGTACTCAGAGAAGATGG - Exonic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032834267 7:135659041-135659063 GTGGCTGCCAAGAGGGAAGAGGG - Intergenic
1033815575 7:145068749-145068771 ATGGCTGACTTTAGGGAAGAGGG - Intergenic
1034281882 7:149860313-149860335 GTGTCTTAGCTGATAGAAGATGG + Intronic
1034532738 7:151706920-151706942 GCGTCTACCATGAGGGAAGAGGG + Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035442173 7:158910745-158910767 GTGTCAGACCTGTGGGTGGAGGG + Intronic
1036374513 8:8188842-8188864 GTGTTTGTCTTGAGGGAAGGCGG - Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036855029 8:12234305-12234327 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1036876390 8:12476793-12476815 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1039919678 8:41884458-41884480 GTGCCTGTCCTGAGGGACGCTGG - Intronic
1040722639 8:50344924-50344946 GTGTCTGACCTGAGGAAATTTGG + Intronic
1041413210 8:57579268-57579290 GTACCTGACCTGAGAGAAGAAGG + Intergenic
1041449373 8:57991189-57991211 GAGTCTGATCTGAGGGCTGAGGG + Intergenic
1042045877 8:64651024-64651046 GTGTTTGAGGTGGGGGAAGACGG + Intronic
1042221282 8:66477314-66477336 GTCTCTGCCCTGTGGGAAGAAGG - Intronic
1042299597 8:67262708-67262730 GTGTCTTACCTGAGTGTTGATGG - Intronic
1042463135 8:69094315-69094337 GTTTCTGACTTGCGGGAGGAGGG - Intergenic
1045270873 8:100660580-100660602 GTCCCTGACCTGACAGAAGAAGG + Intronic
1047354711 8:124109369-124109391 GTGGCTGACAGAAGGGAAGATGG + Intronic
1049398949 8:142416287-142416309 GGGTCTGTCCTGGGGGAAGCCGG + Intergenic
1049470568 8:142773431-142773453 GTGACTCCCCAGAGGGAAGATGG - Intronic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1051333008 9:16042339-16042361 GATTCTGGCCTGAGAGAAGAGGG + Intronic
1051571764 9:18566746-18566768 GTGACAGGCCTGAGGGATGATGG + Intronic
1051817224 9:21122035-21122057 GCCTCTGACCTGAGGTGAGAAGG - Intergenic
1055702292 9:78958414-78958436 AGCTCTGACCTGAGGGAAGGAGG - Intergenic
1056383227 9:86074545-86074567 GTGTCTGCACTGAAGGAAGGCGG + Intronic
1056816067 9:89802049-89802071 GTCGCGGACCTGGGGGAAGAAGG + Intergenic
1057787301 9:98096612-98096634 GTTTCTGGCCTGAGAGATGAAGG - Intronic
1059646655 9:116274835-116274857 GTGTCTGACTGGAGGGCAGAGGG - Intronic
1059994195 9:119893175-119893197 GTGTCTGTCCAGGGGTAAGATGG + Intergenic
1060054847 9:120404483-120404505 GTGACTGACCTATGGTAAGAAGG + Intronic
1060246443 9:121950540-121950562 GAGTCTGACCTGAGGCCAGCAGG + Intronic
1060666917 9:125437208-125437230 GTGTCACCCCTGAGTGAAGAGGG + Intergenic
1061152236 9:128835509-128835531 GTAGCTGCCCTGAGGGATGATGG + Exonic
1061270265 9:129536344-129536366 GTGGCTGGCTTCAGGGAAGAGGG + Intergenic
1203781645 EBV:104283-104305 CTTTCTGACCTCGGGGAAGATGG + Intergenic
1189305862 X:39986232-39986254 GTGTTTTACCTGAAGGAAGGAGG - Intergenic
1190248363 X:48705421-48705443 GTTGCTGGCCTCAGGGAAGAGGG + Intronic
1190757718 X:53415161-53415183 TTGACTTACCTAAGGGAAGAGGG + Exonic
1195004477 X:100672344-100672366 GTGGATGACTTGAGGGGAGAAGG + Intergenic
1196174630 X:112627356-112627378 GCGTGTGACCTGAGCCAAGATGG - Intergenic
1196648901 X:118148542-118148564 GTGCTTGACCTGAGGTAAGATGG - Intergenic