ID: 1039839881

View in Genome Browser
Species Human (GRCh38)
Location 8:41285836-41285858
Sequence CAGGCTCAGGCTAGGGTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039839873_1039839881 -9 Left 1039839873 8:41285822-41285844 CCGGATGGGATGGCCAGGCTCAG 0: 1
1: 0
2: 5
3: 38
4: 410
Right 1039839881 8:41285836-41285858 CAGGCTCAGGCTAGGGTCGGGGG No data
1039839872_1039839881 -6 Left 1039839872 8:41285819-41285841 CCACCGGATGGGATGGCCAGGCT 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1039839881 8:41285836-41285858 CAGGCTCAGGCTAGGGTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039839881 Original CRISPR CAGGCTCAGGCTAGGGTCGG GGG Intronic
No off target data available for this crispr