ID: 1039842189

View in Genome Browser
Species Human (GRCh38)
Location 8:41302088-41302110
Sequence CTATAGATACAGATTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039842189_1039842193 3 Left 1039842189 8:41302088-41302110 CCACCCTCAATCTGTATCTATAG 0: 1
1: 0
2: 3
3: 9
4: 120
Right 1039842193 8:41302114-41302136 TCAGAAAGCACTAGGTATACAGG No data
1039842189_1039842194 4 Left 1039842189 8:41302088-41302110 CCACCCTCAATCTGTATCTATAG 0: 1
1: 0
2: 3
3: 9
4: 120
Right 1039842194 8:41302115-41302137 CAGAAAGCACTAGGTATACAGGG No data
1039842189_1039842192 -5 Left 1039842189 8:41302088-41302110 CCACCCTCAATCTGTATCTATAG 0: 1
1: 0
2: 3
3: 9
4: 120
Right 1039842192 8:41302106-41302128 TATAGAACTCAGAAAGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039842189 Original CRISPR CTATAGATACAGATTGAGGG TGG (reversed) Intronic
900731279 1:4262481-4262503 ATATACAGACAGAGTGAGGGGGG + Intergenic
901906759 1:12419127-12419149 ATATAGATCCAGGATGAGGGTGG - Intronic
907336859 1:53705337-53705359 ATTTAGATGCAGAGTGAGGGAGG - Intronic
907466371 1:54640456-54640478 CTGGAGATAAAGAGTGAGGGAGG + Intergenic
908074609 1:60502233-60502255 CTAGAGATTGGGATTGAGGGAGG + Intergenic
913271438 1:117097566-117097588 CTATAGATACAGATCTAAGCAGG + Intronic
919674031 1:200363651-200363673 TTATAGATAAAGATTGAAGTAGG - Intergenic
920002488 1:202809236-202809258 ACATAGTGACAGATTGAGGGGGG + Exonic
922094715 1:222433502-222433524 CTGTACATACAGGTTAAGGGTGG - Intergenic
922560717 1:226567607-226567629 CTATACAAAGAGATCGAGGGAGG + Intronic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
1063193729 10:3720489-3720511 CAATAAATACAGTTTGAGGTGGG - Intergenic
1064133474 10:12730493-12730515 CTATAGATACACATTGGGGGTGG + Intronic
1065056636 10:21850955-21850977 CTATACATACAGAATGAAGCAGG + Intronic
1076367434 10:129931051-129931073 ATATAGATACAGATATATGGGGG - Intronic
1079513229 11:21235501-21235523 CTATAGAGACTGATGGAGCGGGG + Intronic
1089807724 11:121106439-121106461 CTACAGACCCATATTGAGGGTGG - Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1098292392 12:68968889-68968911 CTAAAGCTCCAGATTGAGGATGG - Intronic
1099266840 12:80457956-80457978 ATATAGATACATATTAATGGGGG - Intronic
1100120586 12:91364888-91364910 CTACTGAAACAGACTGAGGGAGG - Intergenic
1100221361 12:92507654-92507676 CTAAAGATACCGATTAAGGGAGG + Intergenic
1108853125 13:54760417-54760439 CTTTAAATACAAATAGAGGGTGG - Intergenic
1109137446 13:58672308-58672330 CTATATATACATATTTATGGAGG + Intergenic
1111302790 13:86366824-86366846 GTATCCATCCAGATTGAGGGTGG + Intergenic
1114820016 14:26007321-26007343 CAAAAGATACATATTGAAGGTGG - Intergenic
1116069756 14:40028837-40028859 GTAAAGATAGAGATTGAGGGAGG - Intergenic
1116993012 14:51295015-51295037 AAAAAGAGACAGATTGAGGGAGG + Intergenic
1118073233 14:62269216-62269238 CCATAGATAAGGATAGAGGGTGG - Intergenic
1120913329 14:89687802-89687824 AAGTAGATACAGATGGAGGGGGG + Intergenic
1123193315 14:106592229-106592251 TTATGGATACTGATTGTGGGCGG - Intergenic
1125314129 15:38412858-38412880 CTATAGATATATATTTTGGGGGG - Intergenic
1126055399 15:44725461-44725483 CTAAAGATAAAGATTTAGAGGGG - Intergenic
1129670131 15:77603158-77603180 GTATAGATACAGACTGGGTGTGG + Intergenic
1133962619 16:10507735-10507757 CCATAGTTCGAGATTGAGGGTGG - Intergenic
1134273517 16:12755577-12755599 ATAAAGATACATATTGAGGCAGG - Intronic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1139259888 16:65581219-65581241 CTGTAGATACACATTGAGGTTGG + Intergenic
1140757158 16:78078052-78078074 CTATTGATGCACAGTGAGGGTGG + Intergenic
1157440508 18:47708030-47708052 ATATAGATACATATGTAGGGAGG - Intergenic
1158046326 18:53159640-53159662 ATATAGATACAGATAGATTGGGG - Intronic
1158393214 18:57060300-57060322 CTATACACACAGACTGATGGAGG + Intergenic
1158635399 18:59151767-59151789 CTAGAAATACAGCTTGACGGGGG - Intronic
1164309985 19:24037111-24037133 CTACAGATACTGATTCAGGCAGG - Intronic
1164398353 19:27885758-27885780 GTACAGAGACAGAGTGAGGGGGG - Intergenic
1164483691 19:28636666-28636688 TTGTAGATAGAGATTGAGAGGGG + Intergenic
1167847359 19:52175514-52175536 CTAGAGATACAGGTTGGGCGGGG - Intergenic
1167870247 19:52363059-52363081 GTACAGAGACAGAGTGAGGGGGG + Intronic
926179578 2:10629702-10629724 CTTAAGATATAGATTGAGAGAGG - Intronic
927615826 2:24593814-24593836 CTAAAGATACATATTGGGTGAGG - Intronic
928064024 2:28145035-28145057 CTTTAGATTCAGAATGTGGGTGG - Intronic
928496965 2:31842834-31842856 TTATAGACAAAGGTTGAGGGGGG + Intergenic
929453745 2:42052371-42052393 GGATAGATACAGATTCAAGGAGG + Intronic
930434979 2:51329416-51329438 CGACAGATACAGATTGTGTGAGG + Intergenic
938979058 2:136508299-136508321 TTATAGACAAAGATTGAGGCCGG - Intergenic
939970248 2:148650270-148650292 ATATAGATAGATATTGGGGGAGG - Intronic
942831532 2:180242181-180242203 CTAAAGAAACACATTGAAGGTGG + Intergenic
943299369 2:186178675-186178697 ATATAGTTGCAGATTGAGGGTGG - Intergenic
943850261 2:192711522-192711544 CTAGATAAACAGGTTGAGGGTGG + Intergenic
945793570 2:214334246-214334268 CTATAGATAGATCCTGAGGGGGG + Intronic
946545240 2:220733897-220733919 GAATACATACATATTGAGGGAGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1171157377 20:22888780-22888802 CAATGGAAACAGATTGGGGGTGG + Intergenic
1172313339 20:33934504-33934526 CTATCCACCCAGATTGAGGGTGG - Intergenic
1173172155 20:40736154-40736176 ATATAGATACAGGTTGGGGTTGG + Intergenic
1174910671 20:54604241-54604263 CTAAAAATACAGTTTGAGGCCGG - Intronic
1181866570 22:25861929-25861951 CCACAGATACATATGGAGGGTGG - Intronic
1182160375 22:28115522-28115544 CTCTAGATACAGATTTAGCCAGG - Intronic
1182341892 22:29629524-29629546 TTATAGATAAACATTGAGAGGGG + Intronic
1184669332 22:46004547-46004569 AAATAGATCCAGATAGAGGGAGG - Intergenic
949458378 3:4263486-4263508 CTAGAGAGACAGATTGGGGCTGG - Intronic
954049050 3:47957841-47957863 CTGTATATTCTGATTGAGGGAGG - Intronic
954438941 3:50511123-50511145 CAATAGATCCAGACTGAGAGGGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
959656300 3:108808621-108808643 TTAGAGATTCAGATTCAGGGAGG - Intergenic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
964925425 3:161950615-161950637 CTATAGTTACAGTTTTAGGATGG + Intergenic
965305838 3:167061980-167062002 CTATTGATACAAAGTGAGGCTGG + Intergenic
965426790 3:168535028-168535050 CTATAGATTCTGACTGCGGGTGG - Intergenic
966752102 3:183331914-183331936 CCATAGATAAAGGTAGAGGGAGG + Intronic
971370361 4:26014300-26014322 GCATAAATACAGATTGAGGAAGG - Intergenic
974308050 4:60167513-60167535 CTATAGATAAAGATTCAGATAGG + Intergenic
978422050 4:108543286-108543308 CTAAAGATAAAGAGTGTGGGAGG - Intergenic
980000388 4:127480690-127480712 CTAGAGATCCAGATTGGGGAAGG - Intergenic
985216810 4:187662197-187662219 GTATAGACACAGAGTGTGGGGGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
990342296 5:54835383-54835405 CTATGGATATAGATTTAGGTAGG - Intergenic
990439635 5:55831930-55831952 CTATAGATACAACCTGAGAGTGG - Intergenic
991588563 5:68224916-68224938 CTATAAAGACAGCTTGATGGAGG - Intronic
993836090 5:92822202-92822224 CTATAGAGACAGAGGGAGTGGGG + Intergenic
994968643 5:106707235-106707257 CTATATACATAGATTGAAGGAGG - Intergenic
995402311 5:111757215-111757237 CTAGAAAGACAGATTGGGGGGGG + Intronic
995402709 5:111759758-111759780 CTATAGCTACAGTTTGAGTGAGG - Intronic
995966569 5:117914756-117914778 CTATAGATTCTCATTGATGGTGG + Intergenic
998114194 5:139523957-139523979 CTATTGATACAGAAGGACGGGGG + Intergenic
998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG + Intronic
998528112 5:142860944-142860966 CTAGAGATTTTGATTGAGGGTGG + Intronic
1000701394 5:164455616-164455638 CTATAGATACCTAGTGAAGGGGG - Intergenic
1002679921 5:180953352-180953374 TTATAGATGCACATTGAGGGAGG + Intergenic
1003518225 6:6835286-6835308 CTATAGATACAGATAGAGTGGGG - Intergenic
1003963094 6:11227647-11227669 CTCTACATACAAATAGAGGGTGG + Intronic
1004884620 6:20039652-20039674 CTATAAAAACAGAATGAGGCCGG + Intergenic
1008006227 6:46412400-46412422 CTAGAGGTACAGATTGTGGGGGG + Intronic
1008083750 6:47221945-47221967 GTATAGAGACAGAGGGAGGGGGG - Intergenic
1011966445 6:93163814-93163836 CTAAAGGTACAGATTCATGGAGG - Intergenic
1013400807 6:109794534-109794556 CCACAGATACTGATGGAGGGAGG - Intronic
1015849957 6:137561163-137561185 TTAAAGATATATATTGAGGGAGG - Intergenic
1020983498 7:15102205-15102227 CTATTGATACAGATTTACAGGGG + Intergenic
1022429970 7:30308499-30308521 CCAGAGATTCTGATTGAGGGTGG - Intronic
1023266062 7:38407200-38407222 CTATAGATAGATATAGAGAGAGG - Intronic
1023352542 7:39334831-39334853 CAATAAATACAGAGTTAGGGAGG + Intronic
1026459704 7:70603151-70603173 TCATAGACACAGATTGAAGGTGG + Intronic
1028210182 7:88064273-88064295 GTAAAGATACAGGTTGAGGTTGG + Intronic
1029867749 7:103653655-103653677 CTAGAGCTACCGATTGAGGTTGG - Intronic
1037523890 8:19706303-19706325 ATACAGATACAGATTGAGCCTGG - Intronic
1039540004 8:38358424-38358446 CTATGGAAACACATTGAGTGTGG - Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1039931974 8:42000983-42001005 CTATAGATAAAACGTGAGGGAGG + Intronic
1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG + Intergenic
1041786099 8:61636366-61636388 CTATAGAGACAGAGGGAGAGAGG + Intronic
1043432091 8:80205018-80205040 TAATAGTTACAGATTGAGGCTGG + Intronic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1044993060 8:97813431-97813453 GTACCCATACAGATTGAGGGTGG + Intronic
1047124443 8:121944822-121944844 CTATTGAACCAGATTCAGGGAGG + Intergenic
1055689686 9:78816141-78816163 CTAAAAATACAGATTTAGGCGGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1186483854 X:9917895-9917917 CTATAGAAACAGATTGTGTTAGG - Intronic
1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG + Intergenic
1194038291 X:88908173-88908195 CCAAAGCCACAGATTGAGGGAGG + Intergenic
1195430731 X:104786316-104786338 GAACAGATACAGATTGAGGAAGG - Intronic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1198431677 X:136573705-136573727 CTATATATAGAGAGGGAGGGAGG + Intergenic