ID: 1039842190

View in Genome Browser
Species Human (GRCh38)
Location 8:41302091-41302113
Sequence GTTCTATAGATACAGATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039842190_1039842193 0 Left 1039842190 8:41302091-41302113 CCCTCAATCTGTATCTATAGAAC 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1039842193 8:41302114-41302136 TCAGAAAGCACTAGGTATACAGG No data
1039842190_1039842192 -8 Left 1039842190 8:41302091-41302113 CCCTCAATCTGTATCTATAGAAC 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1039842192 8:41302106-41302128 TATAGAACTCAGAAAGCACTAGG No data
1039842190_1039842194 1 Left 1039842190 8:41302091-41302113 CCCTCAATCTGTATCTATAGAAC 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1039842194 8:41302115-41302137 CAGAAAGCACTAGGTATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039842190 Original CRISPR GTTCTATAGATACAGATTGA GGG (reversed) Intronic
906728992 1:48064954-48064976 ATCCTATAGATACTTATTGAGGG + Intergenic
909325171 1:74342392-74342414 GTTGTAAACATACAGATTGTGGG + Intronic
909814327 1:79972884-79972906 TTTCTATATATACAGATAGGTGG + Intergenic
909831077 1:80190711-80190733 GTTTTGTATATACAGATTGTAGG - Intergenic
909844370 1:80373025-80373047 TCTCCATAGATACAGATGGATGG + Intergenic
910356157 1:86358319-86358341 GTTCTATTGCAACAGAATGAAGG - Intronic
912211639 1:107563320-107563342 GTTCTGTAAATACTGATTAAAGG + Intergenic
912484585 1:110015416-110015438 GTTCTATAGATCCTGGATGATGG + Exonic
914001313 1:143697099-143697121 GTTCTAGAAATTCAGCTTGATGG + Intergenic
917421261 1:174866237-174866259 TTTCTATAGATAGATATAGAGGG - Intronic
918893897 1:190315045-190315067 GTTTTATAAACTCAGATTGAAGG + Intronic
920176829 1:204107354-204107376 GTTTTATAGACACAGCTTGCAGG + Intronic
1063370476 10:5518679-5518701 ATCCAATAGATACAGATAGAAGG - Intergenic
1064133473 10:12730490-12730512 GGGCTATAGATACACATTGGGGG + Intronic
1066531132 10:36340551-36340573 ATTTTCTAGATACAGACTGAAGG + Intergenic
1069272725 10:66550299-66550321 GATCTATAAAGACAGACTGAAGG - Intronic
1076813459 10:132901085-132901107 AATGTATAGACACAGATTGAAGG - Intronic
1086236244 11:84634584-84634606 GCTCTATAGTTAGAGATTTATGG - Intronic
1086239157 11:84668565-84668587 GTTCAATAGATGTAGCTTGAAGG - Intronic
1087825481 11:102760021-102760043 GTTGTAAAGATACAGTTAGAAGG + Intergenic
1088051778 11:105524858-105524880 GTTTTAAAGATAAAGATTGAAGG + Intergenic
1088667216 11:112105397-112105419 GTTATATATATACAAATAGATGG + Intronic
1089325512 11:117654150-117654172 AATCTATAGAGACAGATTGGTGG + Intronic
1093124367 12:15310695-15310717 GCTCTCTAGAAACAGATGGAGGG - Intronic
1094278887 12:28711893-28711915 TTTCTATCAATTCAGATTGAAGG + Intergenic
1095704896 12:45225939-45225961 TATGTAAAGATACAGATTGAAGG + Intronic
1099266843 12:80457959-80457981 GTCATATAGATACATATTAATGG - Intronic
1112165124 13:96910126-96910148 GTTCTATATTAACATATTGAAGG + Intergenic
1116234352 14:42258730-42258752 TTTCTATAAATACATATTTATGG - Intergenic
1120981805 14:90296681-90296703 GTTCTATAGGGAAAGAGTGATGG - Intronic
1125102271 15:35928115-35928137 GTTATATAGACACAGTTAGAAGG + Intergenic
1126653087 15:50946480-50946502 GTTATATAAATGCAGACTGATGG - Intronic
1130141891 15:81234204-81234226 ATTCTAAAGACAAAGATTGAAGG - Intronic
1131583146 15:93664825-93664847 GTTTTATAAATGCAGATTGATGG - Intergenic
1134167512 16:11942107-11942129 GTTCCTGAGATACAGGTTGATGG - Intronic
1134493186 16:14711605-14711627 GTTCCTGAGATACAGGTTGATGG + Intronic
1134498567 16:14750729-14750751 GTTCCTGAGATACAGGTTGATGG + Intronic
1134525121 16:14937359-14937381 GTTCCTGAGATACAGGTTGATGG + Intronic
1134547773 16:15123560-15123582 GTTCCTGAGATACAGGTTGATGG - Intronic
1134582007 16:15378356-15378378 GTTCCTGAGATACAGGTTGATGG - Intronic
1134712709 16:16335846-16335868 GTTCCTGAGATACAGGTTGATGG + Intergenic
1134720573 16:16379161-16379183 GTTCCTGAGATACAGGTTGATGG + Exonic
1134946854 16:18332724-18332746 GTTCCTGAGATACAGGTTGATGG - Exonic
1134954118 16:18372847-18372869 GTTCCTGAGATACAGGTTGATGG - Intergenic
1135312944 16:21419759-21419781 GTTCCTGAGATACAGGTTGATGG - Intronic
1135365868 16:21852039-21852061 GTTCCCGAGATACAGGTTGATGG - Intronic
1135445947 16:22519123-22519145 GTTCCTGAGATACAGGTTGATGG + Intronic
1135951134 16:26915337-26915359 TTTCTGTAGATACATATTGTTGG + Intergenic
1136152099 16:28357490-28357512 GTTCCTGAGATACAGGTTGATGG - Intronic
1136194649 16:28643693-28643715 GTTCCTGAGATACAGGTTGATGG + Intronic
1136210981 16:28757792-28757814 GTTCCTGAGATACAGGTTGATGG + Intronic
1136255703 16:29037750-29037772 GTTCCTGAGATACAGGTTGATGG + Intergenic
1136309609 16:29398486-29398508 GTTCCTGAGATACAGGTTGATGG - Intronic
1136323057 16:29500267-29500289 GTTCCTGAGATACAGGTTGATGG - Intronic
1136437741 16:30240235-30240257 GTTCCTGAGATACAGGTTGATGG - Intronic
1139857293 16:69990866-69990888 GTTCCTGAGATACAGGTTGATGG - Intergenic
1140365381 16:74377055-74377077 GTTCCTGAGATACAGGTTGATGG + Intergenic
1140571138 16:76107677-76107699 GTTTTAAATATACAGATGGAAGG - Intergenic
1151132152 17:71908370-71908392 GGTCAATAGATACAGCTTTAAGG + Intergenic
1153132710 18:1875365-1875387 GTTCAATAAATATTGATTGATGG + Intergenic
1154118742 18:11634115-11634137 GTTCCTGAGATACAGGTTGATGG - Intergenic
1155504846 18:26523277-26523299 TTTCTTTAGATACCTATTGAAGG + Intronic
1156822642 18:41391418-41391440 GTCCTATAGATAATGATTGGAGG - Intergenic
1159547740 18:69861308-69861330 GTTCTTTAAATAAAGTTTGAAGG + Exonic
1164463066 19:28464844-28464866 TTTCTAAAGTTACAGAGTGAAGG + Intergenic
1167939184 19:52932598-52932620 GTTCTATATATATGCATTGAAGG + Intronic
925647310 2:6049389-6049411 GTTCTCTAGATATAGAATCATGG - Intergenic
927311468 2:21636613-21636635 GAACTAGAGATACAGTTTGAGGG - Intergenic
927739764 2:25558229-25558251 GATCTACAGGTACAGATTTAGGG - Intronic
928013555 2:27633240-27633262 TTTCTATATACACAGATAGAAGG + Intronic
928444083 2:31317721-31317743 GGTCTGCAGATACAAATTGATGG - Intergenic
931033894 2:58215145-58215167 ATTCTTTAGGTATAGATTGATGG - Intronic
933108877 2:78371969-78371991 GTTTTACAGATACGGATTGTGGG + Intergenic
935121694 2:100188589-100188611 GTTCTAGAGATAAAGCGTGATGG - Intergenic
936002071 2:108842990-108843012 GTTCTATAAATTCTGTTTGACGG - Intronic
938002156 2:127751058-127751080 GTTCTAAAAAATCAGATTGATGG + Intronic
938273453 2:129994960-129994982 GTTGAATAGAGAAAGATTGAGGG + Intergenic
938277770 2:130042212-130042234 GTTGAATAGAGAAAGATTGAGGG + Intergenic
938328736 2:130433016-130433038 GTTGAATAGAGAAAGATTGAGGG + Intergenic
938361209 2:130688476-130688498 GTTGAATAGAGAAAGATTGAGGG - Intergenic
938437613 2:131295165-131295187 GTTGAATAGAGAAAGATTGAGGG - Intronic
940555197 2:155216813-155216835 GTTATATAGATATAGATAGATGG - Intergenic
943103493 2:183513996-183514018 ATACTAGAGATACAGATTTAAGG - Intergenic
946089295 2:217206728-217206750 GCTCAATAGATTCAGCTTGAAGG + Intergenic
947079261 2:226377955-226377977 GCACTATAGATAAAGATAGAAGG - Intergenic
947131136 2:226926062-226926084 TTTCAAAAGATACACATTGAAGG - Intronic
947815482 2:233033847-233033869 GTTCTGTAAATGCATATTGATGG + Intronic
1169808420 20:9583191-9583213 TTAATATAGATACAGATGGATGG - Intronic
1176947891 21:15005995-15006017 ATTCTAGAGATAAATATTGATGG - Intronic
1177094857 21:16820241-16820263 TTTCTATAGACAGAAATTGATGG + Intergenic
1178369060 21:32011918-32011940 GTTCTAGAGATACAGTTTTGGGG - Intronic
1178449218 21:32678397-32678419 CTTCTATAGATTATGATTGAGGG - Intronic
1179838740 21:44056195-44056217 TTTCTATCGATACAGACTCATGG - Intronic
954926136 3:54236559-54236581 GTTCTGTGGATGAAGATTGAGGG + Intronic
958556896 3:95690788-95690810 GTTGCATAGATACATATTTATGG - Intergenic
958669695 3:97187170-97187192 ATTCTGTACATACAGATTTAAGG + Intronic
959487834 3:106948743-106948765 GTTGTATAGAGACAGCATGAGGG - Intergenic
964350848 3:155802589-155802611 GTTCTACAGAAAGAGATTTAAGG + Exonic
965774755 3:172216817-172216839 GTTCCATACATCCAGAGTGACGG - Intronic
970192414 4:13529089-13529111 GTTTTATAGATGGAGACTGAGGG - Intergenic
970819646 4:20197408-20197430 GTTCTAGAGATACAGAGTAAAGG - Intergenic
973170220 4:47133020-47133042 GTAGAATAGATACAGAGTGATGG - Intronic
975640943 4:76499779-76499801 GGTCTAGAAAAACAGATTGAGGG + Intronic
978310175 4:107378874-107378896 TTTCTATAGACACAGGATGAAGG + Intergenic
982087247 4:151848283-151848305 CTTCAAGAGAAACAGATTGAAGG + Intergenic
982159378 4:152552582-152552604 GTCCTCTAGATCAAGATTGATGG - Intergenic
987398162 5:17445380-17445402 CTTCTGTAAATACATATTGAAGG + Intergenic
987568500 5:19624936-19624958 ATTCTATAGCTACCAATTGAAGG - Intronic
989465937 5:41755721-41755743 GTGCTATAGACACAGATTAAAGG + Intronic
990689590 5:58348604-58348626 GTTCAATACAGACACATTGAAGG + Intergenic
993123836 5:83807525-83807547 CTTCTATAACTACAGAATGAGGG + Intergenic
993924016 5:93843087-93843109 GTTCTAAAGATATAGATGGGTGG + Intronic
994535695 5:101026639-101026661 GTTCTATTGCTACTGATGGAAGG - Intergenic
994940562 5:106318151-106318173 GTTTTCTAGATACAGAATCAGGG + Intergenic
994968644 5:106707238-106707260 GTACTATATACATAGATTGAAGG - Intergenic
995715761 5:115080684-115080706 TTTTGATACATACAGATTGAAGG + Intergenic
996887805 5:128379322-128379344 GTTTTAAAGAAAGAGATTGATGG + Intronic
998520324 5:142794358-142794380 GTGCTATAAATACAGAAGGAGGG + Intronic
999120027 5:149202023-149202045 GCTCTATAAATACAGAGTGAGGG + Intronic
1000193254 5:158934006-158934028 GTACGATAGATACTGAATGAGGG - Intronic
1001178818 5:169498967-169498989 TTCATATAGACACAGATTGAAGG - Intergenic
1002679920 5:180953349-180953371 GATTTATAGATGCACATTGAGGG + Intergenic
1003476397 6:6487827-6487849 GTTCTCCAGATACAGACTGAAGG - Intergenic
1003639719 6:7866369-7866391 GTTCTATAGCTCCAGTTTGGTGG + Intronic
1003801371 6:9672372-9672394 GTTCTAGAGATCAAGATTAAGGG + Intronic
1005136645 6:22576403-22576425 GTTCTCTGGATACACATGGAAGG - Intergenic
1005632094 6:27717754-27717776 GTGGTATAGATCCAGTTTGAAGG - Intergenic
1008502345 6:52196255-52196277 GTTTTATATATATATATTGATGG - Intergenic
1011262957 6:85487572-85487594 GATCGATAGCTACAGAATGAGGG + Intronic
1011416849 6:87130672-87130694 GTGCTATATATACAGAATCAGGG - Intergenic
1011526553 6:88271684-88271706 GTACTAGAGACACAGATTCAGGG + Intergenic
1012541830 6:100370065-100370087 GATCCATAGATCCAGATGGATGG + Intergenic
1013741535 6:113292649-113292671 GTTTTATAGATAAAGATTCAGGG - Intergenic
1013772005 6:113638184-113638206 GATCTAGAGATTCACATTGATGG - Intergenic
1014983540 6:127974825-127974847 GTTCTACTGATACAGAGTGTAGG - Intronic
1017963945 6:159247284-159247306 GTTTTATAAATAAAGGTTGAAGG - Intronic
1020503096 7:8947859-8947881 GTTCTGCAGATATAGATTGTAGG - Intergenic
1020766808 7:12332086-12332108 GTTCTATGGATACCCATGGATGG + Intronic
1021378940 7:19943012-19943034 GTTCTATAGCTACAGAAAGCAGG + Intergenic
1022424635 7:30256736-30256758 TTTTTATATATACAAATTGAAGG + Intergenic
1024270840 7:47640202-47640224 GAGCTATAGATACTGAATGAAGG + Intergenic
1028885621 7:95929221-95929243 GTTCAATAAATACAGGGTGAAGG - Intronic
1028923263 7:96329813-96329835 GTTATTTAGACAGAGATTGATGG - Intergenic
1030091716 7:105863984-105864006 ATTCTATAGATCCAGGTTCAGGG - Intronic
1031239478 7:119219561-119219583 GTTCCATAGATACAGATTATAGG - Intergenic
1039677006 8:39679253-39679275 GTTCAATAGAGACAGATCAATGG + Intronic
1039842190 8:41302091-41302113 GTTCTATAGATACAGATTGAGGG - Intronic
1042242901 8:66682237-66682259 GATCTATAGATACTGATTTTTGG + Intronic
1044151107 8:88775574-88775596 AATCTGTAGATACAGATTAAGGG - Intergenic
1055383539 9:75735717-75735739 CTTCTTCAGATACAGAGTGAGGG - Intergenic
1056664337 9:88569344-88569366 TTTCTATATATAAAGTTTGAAGG - Intronic
1057723312 9:97550076-97550098 AATCCATAGATACAGATTGGTGG - Intronic
1057835111 9:98438211-98438233 GGTGTATAGATATAGATGGATGG - Intronic
1058476058 9:105334178-105334200 GTTCTATCTATGCAGATAGAAGG - Intronic
1059740376 9:117144126-117144148 TTTCTATGGACACAGACTGAGGG + Intronic
1059878440 9:118662141-118662163 GAACTATAGATACAGAGTGTTGG + Intergenic
1059947496 9:119426307-119426329 GATCTATAGATCAAGATTTAAGG - Intergenic
1061411418 9:130423920-130423942 GTTCAACAAATACCGATTGAGGG - Intronic
1185498676 X:580635-580657 GATATATAGATAATGATTGATGG + Intergenic
1185498688 X:580831-580853 GATATATAGATAATGATTGATGG + Intergenic
1185498697 X:580974-580996 GATATATAGATAATGATTGATGG + Intergenic
1186303081 X:8221637-8221659 GATTTATAGATAAAGATGGATGG + Intergenic
1187606404 X:20888183-20888205 GTTCTATACATAAAAATTAATGG - Intergenic
1187921185 X:24203457-24203479 GCTATATAGAGACAGATTTAGGG - Intronic
1188087769 X:25921994-25922016 GTTGTATAGATCAACATTGAAGG + Intergenic
1188591909 X:31847252-31847274 GTTCTATAGAAACAGAGCAATGG + Intronic
1191205648 X:57831291-57831313 GTTCTATACATAAAAATTAATGG - Intergenic
1193092974 X:77513835-77513857 GTTTTCTAGATACAGAATCATGG - Intronic
1193460133 X:81781153-81781175 GCTCTATGGATACAAATTTATGG + Intergenic
1193814408 X:86087438-86087460 TTTCAAAAGATACAGATTTACGG + Intergenic
1194992770 X:100562879-100562901 CTTTTAAAGATACAGATTGGTGG - Intergenic
1195228524 X:102822780-102822802 TTTCTATATATACTGATTCATGG + Intergenic
1195881975 X:109601866-109601888 ATTCTATAGATAAACATGGAAGG + Intergenic
1197045642 X:121994739-121994761 ATTCTTTAGATACACATTGTTGG + Intergenic
1199817506 X:151411767-151411789 GTGCTACAGATACAGATGGGAGG - Intergenic
1200840804 Y:7779750-7779772 GTTTTATACAAATAGATTGATGG - Intergenic