ID: 1039842191

View in Genome Browser
Species Human (GRCh38)
Location 8:41302092-41302114
Sequence AGTTCTATAGATACAGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039842191_1039842194 0 Left 1039842191 8:41302092-41302114 CCTCAATCTGTATCTATAGAACT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1039842194 8:41302115-41302137 CAGAAAGCACTAGGTATACAGGG No data
1039842191_1039842192 -9 Left 1039842191 8:41302092-41302114 CCTCAATCTGTATCTATAGAACT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1039842192 8:41302106-41302128 TATAGAACTCAGAAAGCACTAGG No data
1039842191_1039842193 -1 Left 1039842191 8:41302092-41302114 CCTCAATCTGTATCTATAGAACT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1039842193 8:41302114-41302136 TCAGAAAGCACTAGGTATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039842191 Original CRISPR AGTTCTATAGATACAGATTG AGG (reversed) Intronic
904609990 1:31720588-31720610 AGTTCTGTGGATCCAGATAGGGG - Intergenic
905718813 1:40177792-40177814 AGTTCTTTAGATATAGATATAGG + Intronic
908619139 1:65956527-65956549 AGAAGTATAGATATAGATTGCGG + Intronic
909325170 1:74342391-74342413 TGTTGTAAACATACAGATTGTGG + Intronic
910013097 1:82489684-82489706 AGTGCTATAAATATACATTGGGG + Intergenic
910862867 1:91759850-91759872 GGTTGTATAGACACAGATCGTGG - Intronic
915213708 1:154327094-154327116 AGCTCTATAATTACAGATTCTGG - Intronic
916646913 1:166795882-166795904 AGTTTACTAGCTACAGATTGTGG + Intergenic
917421262 1:174866238-174866260 ATTTCTATAGATAGATATAGAGG - Intronic
917729764 1:177862914-177862936 AGATCTATTAATGCAGATTGTGG + Intergenic
918569681 1:185974870-185974892 AGTTTTGTTGGTACAGATTGAGG + Intronic
918882883 1:190148660-190148682 AGTACTATAAATAAAGAATGAGG - Intronic
919036363 1:192314311-192314333 AGAACTAAAGATACAGATTGAGG - Intergenic
919296533 1:195708720-195708742 AGTTCTTTAAAAACATATTGGGG - Intergenic
919478288 1:198055749-198055771 AACACTATAGATACATATTGAGG - Intergenic
920240340 1:204543085-204543107 AGGACTAGAGATACAGATTTGGG - Intronic
921274334 1:213503639-213503661 ATTTCTATATCTAGAGATTGGGG + Intergenic
921458358 1:215398626-215398648 AGTTCTATAGCTACAGTTGCCGG - Intergenic
921549690 1:216519630-216519652 AGTTTTATAGACACAGCTTAGGG + Intronic
922805486 1:228385223-228385245 AGATATAAAGATACAGATAGAGG + Intergenic
1064133472 10:12730489-12730511 TGGGCTATAGATACACATTGGGG + Intronic
1065150933 10:22822580-22822602 AGTTCTATAAATACATAAGGTGG + Intergenic
1065779826 10:29156967-29156989 AGTTCAATAGCTACACATTCTGG - Intergenic
1066054832 10:31671091-31671113 AGTTCTAAAGAGACAGAGGGAGG + Intergenic
1066078974 10:31910683-31910705 AGTTTTATACATCAAGATTGTGG + Intronic
1067680680 10:48437048-48437070 ATCTCTATTGATACAGATTTTGG + Exonic
1067917041 10:50411204-50411226 AATTCTTTAAATACAGAGTGTGG - Intronic
1068499189 10:57821408-57821430 AATTGTGTAGATACAGAATGGGG - Intergenic
1071053424 10:81479373-81479395 AGCACTATAAATACATATTGAGG - Intergenic
1071219733 10:83451386-83451408 ACATCTATAGATACAGAAAGTGG + Intergenic
1074794313 10:116925601-116925623 ATATCTATAGATACAGATATAGG - Intronic
1079589933 11:22169938-22169960 AATTGTATGTATACAGATTGAGG - Intergenic
1080355349 11:31437959-31437981 AGTTTCATAGATAAACATTGTGG - Intronic
1082019317 11:47518442-47518464 AGTTCTATAAATACAGCTTTTGG + Intronic
1082160088 11:48881086-48881108 AGTACTATCCATACATATTGGGG + Intergenic
1082162278 11:48899320-48899342 AGTACTATCCATACATATTGGGG - Intergenic
1083354425 11:62055580-62055602 AGTTCTGTTGAGACAGTTTGGGG - Intergenic
1085880341 11:80460016-80460038 AGTTTTATAGCTCCAGAATGGGG - Intergenic
1091025158 11:132135417-132135439 AGTTCTCTAGAGGCAGATTCTGG + Intronic
1093192820 12:16094544-16094566 ATTTCTATAGATACAGTTATTGG - Intergenic
1097104121 12:56610611-56610633 AGTTCTAGAGATACAAATGTGGG - Intronic
1097781951 12:63716978-63717000 TGTTCTATAGATATACTTTGGGG - Intergenic
1099152131 12:79127390-79127412 AGTTCTTACGAAACAGATTGTGG + Intronic
1100154956 12:91787514-91787536 TGTTCTATAGGAACAGATTTTGG + Intergenic
1101615594 12:106333934-106333956 AGGGCTATAGATACAGATTTAGG + Intronic
1106856079 13:33854588-33854610 AGTTCCATAGCTACAGATGGTGG + Intronic
1107401290 13:40072011-40072033 AGAACTATAGATACAAATTCAGG - Intergenic
1109830091 13:67774211-67774233 AGTACTAGAGATACAAATTTTGG + Intergenic
1111020875 13:82449191-82449213 AGTTCTATATGTTCAGATTTTGG - Intergenic
1111156807 13:84338258-84338280 AGTTTTATAGGCACAGAATGGGG + Intergenic
1111403899 13:87777219-87777241 ACTTCTAAAGATACATATTTTGG + Intergenic
1111538870 13:89644016-89644038 AGTTCTATTGACATAGAGTGTGG + Intergenic
1117075775 14:52102600-52102622 AATGCTATAGATACAAAATGAGG - Intergenic
1125956515 15:43794125-43794147 AACTCTTTAGATTCAGATTGTGG + Exonic
1126667464 15:51088437-51088459 AGTTTTACAGATCCAGTTTGAGG + Intronic
1128239474 15:66091998-66092020 ATTTCTATACACACAGACTGTGG + Intronic
1130852808 15:87813726-87813748 TGTTCTATTGATTAAGATTGAGG - Intergenic
1131788180 15:95935307-95935329 AGGTCTAAGGATACAGATTATGG + Intergenic
1137251666 16:46745767-46745789 AGTTCTGGTGCTACAGATTGTGG + Intronic
1140851373 16:78937913-78937935 AGTTCTATAGCCACACATGGTGG - Intronic
1146564487 17:33900688-33900710 AGTTTTATACATACTCATTGAGG + Intronic
1147510944 17:41068459-41068481 AGCAGTATAGATACAGCTTGTGG - Intergenic
1147620387 17:41862833-41862855 GGAGCTAGAGATACAGATTGGGG - Intronic
1149160758 17:53689804-53689826 AGTCCTATAGAAACAGACTATGG - Intergenic
1149463097 17:56849904-56849926 AGAGCTAGAGATGCAGATTGAGG + Intronic
1150250661 17:63702547-63702569 AGTTCCAAAGATTGAGATTGAGG - Intergenic
1151019972 17:70603521-70603543 TGTTCTAAAGATATAGAATGTGG + Intergenic
1151366562 17:73620812-73620834 AAATCCACAGATACAGATTGTGG + Intronic
1155113474 18:22739140-22739162 ATTGCTATAGACACAGCTTGAGG + Intergenic
1155752844 18:29450984-29451006 TGTTCTAAAGATACAAAATGAGG + Intergenic
1156607955 18:38690925-38690947 TGCTCTATAGATACAGAGTGGGG + Intergenic
1159053114 18:63440274-63440296 AGTTATATTGATGGAGATTGTGG + Intergenic
1159111849 18:64069098-64069120 AATACTATAGATACAGCTTCAGG - Intergenic
1165735141 19:38171008-38171030 AGTTGTATATATACATACTGAGG - Intronic
927311469 2:21636614-21636636 AGAACTAGAGATACAGTTTGAGG - Intergenic
927739765 2:25558230-25558252 AGATCTACAGGTACAGATTTAGG - Intronic
930238744 2:48913706-48913728 ATTTCTATTGGTACAGATTTAGG + Intergenic
930405944 2:50955880-50955902 AGTTCTGTAGCTACAGACTGGGG + Intronic
932877034 2:75463548-75463570 TGTCCTAGAGATACAGATTTTGG - Intergenic
933108876 2:78371968-78371990 GGTTTTACAGATACGGATTGTGG + Intergenic
935858402 2:107300081-107300103 ATTTCTATAGATACACAACGAGG - Intergenic
937539547 2:122931644-122931666 AGTTCTATAGATCCAAAGTCTGG - Intergenic
938273452 2:129994959-129994981 AGTTGAATAGAGAAAGATTGAGG + Intergenic
938277769 2:130042211-130042233 AGTTGAATAGAGAAAGATTGAGG + Intergenic
938328735 2:130433015-130433037 AGTTGAATAGAGAAAGATTGAGG + Intergenic
938361210 2:130688477-130688499 AGTTGAATAGAGAAAGATTGAGG - Intergenic
938437614 2:131295166-131295188 AGTTGAATAGAGAAAGATTGAGG - Intronic
940566016 2:155361058-155361080 AGTTTTATAGTTGCATATTGTGG + Intergenic
944337906 2:198559317-198559339 ATTACTATATATACAAATTGTGG + Intronic
1168878789 20:1188866-1188888 AGTTATCTAGATACAGAATTTGG - Intronic
1169365119 20:4985791-4985813 ACATCTATAGAAACAGACTGCGG + Intronic
1171157375 20:22888776-22888798 AGGTCAATGGAAACAGATTGGGG + Intergenic
1173172154 20:40736150-40736172 AGAGATATAGATACAGGTTGGGG + Intergenic
1174123545 20:48285923-48285945 AATTCTTTAAATACAGAGTGAGG - Intergenic
1176376659 21:6090085-6090107 AGCTCTATAGACACGGAGTGTGG + Intergenic
1176515204 21:7778628-7778650 AGTTATATAGATGGAGAATGAGG + Intergenic
1178369061 21:32011919-32011941 TGTTCTAGAGATACAGTTTTGGG - Intronic
1178649232 21:34408640-34408662 AGTTATATAGATGGAGAATGAGG + Intergenic
1179746816 21:43448159-43448181 AGCTCTATAGACACGGAGTGTGG - Intergenic
1182535020 22:30994599-30994621 AGGTCTTCAGATGCAGATTGGGG - Intergenic
951636899 3:24789074-24789096 GGTTCTAGAAATACAGAATGCGG + Intergenic
954786063 3:53093290-53093312 AGCTCTAGAGATACAGAGAGTGG - Intronic
956195348 3:66648875-66648897 AAATCTTTAGATACTGATTGGGG + Intergenic
956693886 3:71902355-71902377 AGTTCTATAGAAACACAGCGAGG + Intergenic
959176427 3:102917986-102918008 AGTTCTATAGATAATTATTCAGG - Intergenic
959445960 3:106439815-106439837 AGTTCAAAAAATACAGATGGGGG + Intergenic
960736106 3:120782345-120782367 AGTTCTAAAGACACAAATTCTGG - Exonic
962093781 3:132272479-132272501 AGTTCAATAGATGCAGAGTTGGG + Intronic
963580524 3:147121217-147121239 AGTGCAATAGAAACATATTGAGG - Intergenic
965247968 3:166299904-166299926 AGGTATATGGAAACAGATTGAGG - Intergenic
970120162 4:12744870-12744892 AATTCTAAAGTTACAGGTTGAGG - Intergenic
971024294 4:22572900-22572922 ATTTCTACAGATAAAGGTTGTGG - Intergenic
971279753 4:25233690-25233712 AAATCTATAGTTACAGATTATGG + Intronic
977037876 4:91977905-91977927 AGTTCTAAAGAAACAAATTTTGG - Intergenic
979046865 4:115878112-115878134 TGCTCTATAAATACAGTTTGGGG + Intergenic
980408758 4:132387262-132387284 AGATATATATATACACATTGTGG + Intergenic
982530379 4:156534099-156534121 AGTTCTAGATATACAGTTTAAGG + Intergenic
983510080 4:168599761-168599783 ATTTCTATAGACACAGGTTCTGG - Intronic
984268941 4:177527140-177527162 ATTTCTATAGACACATATTTTGG - Intergenic
988071334 5:26291878-26291900 AGTTATATAGATATAGATATAGG + Intergenic
988462559 5:31453527-31453549 ACTTCCAAAGATACAGATTTGGG - Intronic
988622694 5:32839904-32839926 ATATCTATAGATACAGATACAGG - Intergenic
989604539 5:43231323-43231345 AGATATATAGATATAGATAGAGG - Intronic
993175228 5:84475533-84475555 TGTTGCATAGAGACAGATTGAGG + Intergenic
993542899 5:89174378-89174400 AGTTCTAAATACACAGATTCTGG + Intergenic
995160111 5:108969349-108969371 AGTTCTATATGTACTGACTGGGG + Intronic
996861678 5:128074068-128074090 AGTTCCTTAGAAACAGACTGAGG + Intergenic
999120026 5:149202022-149202044 TGCTCTATAAATACAGAGTGAGG + Intronic
1000193255 5:158934007-158934029 AGTACGATAGATACTGAATGAGG - Intronic
1003690527 6:8349262-8349284 TGTGCTATAAATACAGATTTGGG - Intergenic
1004884619 6:20039648-20039670 TGTTCTATAAAAACAGAATGAGG + Intergenic
1010236434 6:73578845-73578867 ACTTACATAGATACAGATTTGGG - Intergenic
1011229007 6:85138944-85138966 AGGTCTGAAGATACAGATTTAGG - Intergenic
1011262956 6:85487571-85487593 AGATCGATAGCTACAGAATGAGG + Intronic
1011526552 6:88271683-88271705 AGTACTAGAGACACAGATTCAGG + Intergenic
1013741536 6:113292650-113292672 GGTTTTATAGATAAAGATTCAGG - Intergenic
1014641560 6:123916884-123916906 AGTTCTCTTGATACAGAGAGAGG - Intronic
1014996448 6:128151389-128151411 AGCTATATAGATAAAGATTAAGG - Intronic
1016804600 6:148200270-148200292 AGTTCTAAAGACACAAAATGAGG - Intergenic
1017553103 6:155531692-155531714 TGTTCTATAGAAAGAAATTGAGG + Intergenic
1018303667 6:162430550-162430572 AGTTGTATAAATACAGAATGGGG + Intronic
1021926084 7:25535013-25535035 AGGTCTATACATACAAAATGGGG - Intergenic
1026462576 7:70628075-70628097 ATTTCTATAAATAGAAATTGTGG + Intronic
1027894320 7:84021599-84021621 AGTTTTATAGATTCTAATTGTGG - Intronic
1027902729 7:84137862-84137884 AATACTATAGCTACAGATTTTGG + Intronic
1028426077 7:90690671-90690693 CGTTCTCTAGCTACAGAATGAGG + Intronic
1030655763 7:112165931-112165953 AGTGCTAGAGATACAGAAAGTGG - Intronic
1039842191 8:41302092-41302114 AGTTCTATAGATACAGATTGAGG - Intronic
1041081705 8:54220849-54220871 ATTTCTTTATTTACAGATTGAGG + Intergenic
1041672529 8:60506363-60506385 AGTGCTATAGATAAAGAGAGAGG - Intergenic
1043780443 8:84327410-84327432 AGGTCTATAGAGGCAGCTTGTGG + Intronic
1047269214 8:123338918-123338940 AGTTCTTTAGACAGAGATGGGGG + Intronic
1049051415 8:140199693-140199715 AGATCTGTGGATATAGATTGTGG - Intronic
1049123353 8:140760527-140760549 AAATCTATAGATACAGAAAGTGG + Intronic
1051457665 9:17279188-17279210 AATTCTTAAGATACAAATTGGGG - Intronic
1051796294 9:20874946-20874968 TGTTCTATTGAAACAGCTTGAGG + Intronic
1055383540 9:75735718-75735740 ACTTCTTCAGATACAGAGTGAGG - Intergenic
1061411419 9:130423921-130423943 AGTTCAACAAATACCGATTGAGG - Intronic
1186313640 X:8346065-8346087 AGATCTATAAATGCAGATGGTGG - Intergenic
1188839923 X:35003960-35003982 AGATTTATAAATAGAGATTGTGG + Intergenic
1190857172 X:54307537-54307559 AGTTCAATAGATACAGTATTTGG - Intronic
1193480556 X:82022491-82022513 AGTTCTCAAGAGAAAGATTGGGG + Intergenic
1193663141 X:84281369-84281391 GGTTTTCTAGATACAGATTTAGG + Intergenic
1196200613 X:112882040-112882062 AGTTGTAGAGAAAGAGATTGAGG + Intergenic
1197310292 X:124896480-124896502 AGTTCTATAGCTACAATTTTAGG + Intronic
1202165323 Y:21981143-21981165 AGTTTTATAGCTTCAGATAGTGG - Intergenic
1202226034 Y:22605230-22605252 AGTTTTATAGCTTCAGATAGTGG + Intergenic
1202317080 Y:23590435-23590457 AGTTTTATAGCTTCAGATAGTGG - Intergenic
1202553685 Y:26079623-26079645 AGTTTTATAGCTTCAGATAGTGG + Intergenic