ID: 1039842192

View in Genome Browser
Species Human (GRCh38)
Location 8:41302106-41302128
Sequence TATAGAACTCAGAAAGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039842189_1039842192 -5 Left 1039842189 8:41302088-41302110 CCACCCTCAATCTGTATCTATAG 0: 1
1: 0
2: 3
3: 9
4: 120
Right 1039842192 8:41302106-41302128 TATAGAACTCAGAAAGCACTAGG No data
1039842191_1039842192 -9 Left 1039842191 8:41302092-41302114 CCTCAATCTGTATCTATAGAACT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1039842192 8:41302106-41302128 TATAGAACTCAGAAAGCACTAGG No data
1039842190_1039842192 -8 Left 1039842190 8:41302091-41302113 CCCTCAATCTGTATCTATAGAAC 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1039842192 8:41302106-41302128 TATAGAACTCAGAAAGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039842192 Original CRISPR TATAGAACTCAGAAAGCACT AGG Intronic
No off target data available for this crispr