ID: 1039842192 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:41302106-41302128 |
| Sequence | TATAGAACTCAGAAAGCACT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039842189_1039842192 | -5 | Left | 1039842189 | 8:41302088-41302110 | CCACCCTCAATCTGTATCTATAG | 0: 1 1: 0 2: 3 3: 9 4: 120 |
||
| Right | 1039842192 | 8:41302106-41302128 | TATAGAACTCAGAAAGCACTAGG | No data | ||||
| 1039842191_1039842192 | -9 | Left | 1039842191 | 8:41302092-41302114 | CCTCAATCTGTATCTATAGAACT | 0: 1 1: 0 2: 0 3: 7 4: 161 |
||
| Right | 1039842192 | 8:41302106-41302128 | TATAGAACTCAGAAAGCACTAGG | No data | ||||
| 1039842190_1039842192 | -8 | Left | 1039842190 | 8:41302091-41302113 | CCCTCAATCTGTATCTATAGAAC | 0: 1 1: 0 2: 0 3: 9 4: 166 |
||
| Right | 1039842192 | 8:41302106-41302128 | TATAGAACTCAGAAAGCACTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039842192 | Original CRISPR | TATAGAACTCAGAAAGCACT AGG | Intronic | ||
| No off target data available for this crispr | |||||