ID: 1039842194 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:41302115-41302137 |
Sequence | CAGAAAGCACTAGGTATACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1039842191_1039842194 | 0 | Left | 1039842191 | 8:41302092-41302114 | CCTCAATCTGTATCTATAGAACT | 0: 1 1: 0 2: 0 3: 7 4: 161 |
||
Right | 1039842194 | 8:41302115-41302137 | CAGAAAGCACTAGGTATACAGGG | No data | ||||
1039842190_1039842194 | 1 | Left | 1039842190 | 8:41302091-41302113 | CCCTCAATCTGTATCTATAGAAC | 0: 1 1: 0 2: 0 3: 9 4: 166 |
||
Right | 1039842194 | 8:41302115-41302137 | CAGAAAGCACTAGGTATACAGGG | No data | ||||
1039842189_1039842194 | 4 | Left | 1039842189 | 8:41302088-41302110 | CCACCCTCAATCTGTATCTATAG | 0: 1 1: 0 2: 3 3: 9 4: 120 |
||
Right | 1039842194 | 8:41302115-41302137 | CAGAAAGCACTAGGTATACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1039842194 | Original CRISPR | CAGAAAGCACTAGGTATACA GGG | Intronic | ||
No off target data available for this crispr |