ID: 1039842205

View in Genome Browser
Species Human (GRCh38)
Location 8:41302277-41302299
Sequence TTGTGGATGAAGATGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039842205_1039842210 10 Left 1039842205 8:41302277-41302299 CCAGCTTCCATCTTCATCCACAA 0: 1
1: 0
2: 3
3: 22
4: 334
Right 1039842210 8:41302310-41302332 CTGAGAATGACCCTGTCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039842205 Original CRISPR TTGTGGATGAAGATGGAAGC TGG (reversed) Intronic
900005172 1:40582-40604 TTGGGGATGGGGATGGAAGTGGG - Intergenic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
901509191 1:9707277-9707299 TTGTTGATGAAGATGAAGGCTGG - Intronic
902711024 1:18239795-18239817 ATGTGGAAGAAGATTGAAGGGGG - Intronic
902712086 1:18247374-18247396 TGGTGGATGAGGCTGGCAGCAGG - Intronic
903351429 1:22718974-22718996 ATGTTGATGGAGCTGGAAGCTGG - Intronic
903387328 1:22936025-22936047 TTGTGGTTGGAGAGGGGAGCGGG - Intergenic
904833767 1:33321868-33321890 TTGTGGATCATGATGGAAATAGG + Intergenic
905174197 1:36125796-36125818 GTGTGGAGGAAGATAGAGGCAGG + Intergenic
906045660 1:42829003-42829025 TTATGGTTGAAGGTGGAAGTAGG - Intronic
908403006 1:63788519-63788541 TTGTGGATCAAGAAGGAAAGAGG + Intronic
908451499 1:64260190-64260212 TTGGGGATCAAGGTGGCAGCAGG - Intronic
910452428 1:87360709-87360731 ATGTGGATGATGATTAAAGCGGG + Intergenic
910600557 1:89027370-89027392 TCATGGATGGAGATGGAAGTTGG - Intergenic
911351999 1:96764039-96764061 TTTTAGATAAAGCTGGAAGCTGG - Intronic
913462032 1:119097866-119097888 TGATGGATGAAGATAGAGGCAGG + Intronic
915146028 1:153796211-153796233 TTCTGGATGTTGGTGGAAGCGGG - Intergenic
916152055 1:161803613-161803635 ATGTTGATAATGATGGAAGCTGG + Intronic
916959639 1:169876029-169876051 TTGTGAGTGAAGATGGACACTGG - Exonic
917032987 1:170715611-170715633 TTGTGGGAGAAGATAGAAGATGG + Intronic
917048481 1:170890925-170890947 AAGAGGATGAAGCTGGAAGCGGG - Intergenic
919876609 1:201873790-201873812 TTCTGAATGAAGCTGGAAGCTGG - Intronic
921048355 1:211493150-211493172 TGATGGATGAAGAGGGAAGGCGG - Intergenic
922248434 1:223823284-223823306 TTAGGGATGATGATGGAAACTGG + Intronic
924604919 1:245525130-245525152 TTCTGCATGAAGCTGGCAGCTGG - Intronic
924859011 1:247901974-247901996 TAGTGTTGGAAGATGGAAGCTGG + Intergenic
1063457518 10:6194696-6194718 TTGTGGATTCAGTGGGAAGCTGG + Intronic
1064871059 10:19937439-19937461 CTGTGGATGAAGTTGCCAGCAGG - Intronic
1065147123 10:22780852-22780874 TTGTGGATCAAGAGGAAAGGAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066031941 10:31436674-31436696 TTGTGGATCAGGGTTGAAGCAGG + Intronic
1067142671 10:43669739-43669761 GTGTGGAGGGAGATGGGAGCTGG + Intergenic
1071756219 10:88543257-88543279 CTGTGGATGAAAATGGGGGCTGG - Intronic
1072039878 10:91596841-91596863 TTGGGGAGGAGGATGGAAGAGGG + Intergenic
1072531386 10:96322875-96322897 TTCTGGATCAAGATGTCAGCAGG + Intronic
1073381705 10:103082757-103082779 TTTTGGATGAGGATGGAGGCAGG + Exonic
1073741301 10:106410172-106410194 CTGTTTTTGAAGATGGAAGCGGG + Intergenic
1074388556 10:113037130-113037152 TTGTAGAAGATGAAGGAAGCTGG + Intronic
1074946954 10:118289327-118289349 TTCTGGATGAAGATGATAGATGG + Intergenic
1074964058 10:118473251-118473273 TTGTGGAGGGAGGTGGAGGCAGG - Intergenic
1074971711 10:118544493-118544515 TGGTTCATGAGGATGGAAGCAGG + Intergenic
1076307937 10:129477844-129477866 TTGTGTATGAAGTTGGAATTTGG + Intronic
1076557383 10:131336084-131336106 TTCAAGATGAAGATGCAAGCAGG - Intergenic
1077167599 11:1150743-1150765 GGGAAGATGAAGATGGAAGCAGG + Intergenic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1079250875 11:18786663-18786685 CTGTGGCTGCAGATGGAATCTGG + Intronic
1079304131 11:19307681-19307703 TTGTGGATGAAGATGAAGCATGG - Intergenic
1079766651 11:24402075-24402097 TTCTGGATGAAGAGGTCAGCAGG - Intergenic
1081836565 11:46160300-46160322 TTGTGGCTGCAGATGCCAGCAGG + Intergenic
1081989397 11:47329652-47329674 TTGGGAATGCAGAAGGAAGCAGG - Exonic
1082286225 11:50320944-50320966 TTGTGGATGAGGACAAAAGCCGG - Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1086064437 11:82731800-82731822 GGGTGGAGGGAGATGGAAGCAGG + Exonic
1087069568 11:94064397-94064419 TTGTGGATGAGAATCAAAGCTGG + Exonic
1089206705 11:116770192-116770214 TTGTGGATGATGATGTGAGCTGG - Exonic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091379159 12:44757-44779 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1091855502 12:3736139-3736161 ATGGGGAAGAAGATGGAAGGAGG + Intronic
1094045823 12:26165802-26165824 TTGTGTTTGAAGGTGGCAGCTGG + Intronic
1095614518 12:44172405-44172427 ATGTGAATGAAGATGGAGGCAGG - Intronic
1095790348 12:46160552-46160574 TTATGGAAAAAGATGGAATCTGG + Intergenic
1096486537 12:51985809-51985831 TTCTGCATGAAGTGGGAAGCAGG - Intronic
1098823859 12:75268984-75269006 TTGTAGATGAAGACAGAATCAGG - Intergenic
1099876926 12:88419225-88419247 ATGGGGATGAAGAAGGAATCGGG - Intergenic
1101194968 12:102372432-102372454 TTATGGATGAAGATGGCATGAGG - Intergenic
1103859072 12:123997409-123997431 TTCTGGATTAAGGTGGCAGCAGG + Intronic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400649 12:128473239-128473261 GTGAGGATGAAGATAGACGCTGG - Intronic
1104400675 12:128473479-128473501 GTAAGGATGAAGATAGAAGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400683 12:128473545-128473567 GTAAGGATGAAGATGGATGCTGG - Intronic
1104400695 12:128473665-128473687 GTGAGGATGAAGATAGAAGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1105160547 13:17425748-17425770 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
1105161435 13:17439683-17439705 TTGAGGATTACGTTGGAAGCGGG + Intergenic
1106669173 13:31886642-31886664 TTCTGGCTGGAGATGGAGGCAGG - Intergenic
1108379403 13:49841880-49841902 ATGTGGATGCAGATGGAAGCAGG + Intergenic
1108541436 13:51451459-51451481 TAGTGGAAGCAGATGGGAGCCGG + Intronic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1112920694 13:104608583-104608605 TTGTGGGTGATGGGGGAAGCAGG - Intergenic
1114251752 14:20967884-20967906 TGGTTGATGAAGGTGGAAGAAGG + Intergenic
1115351436 14:32399687-32399709 TTGTTGAGGATGATAGAAGCTGG + Intronic
1115479147 14:33844633-33844655 TGATGGATAAAGATGAAAGCTGG + Intergenic
1115622894 14:35157976-35157998 TTGAGGATGAGGATGCAAACTGG - Intronic
1116340963 14:43722645-43722667 GTGTGGATGCACACGGAAGCAGG + Intergenic
1118004853 14:61556146-61556168 TTGTGGATGAAAGAGAAAGCAGG + Intronic
1118885929 14:69865886-69865908 TTGTGGGTGAAGTAGGCAGCTGG + Intronic
1119799371 14:77429208-77429230 CTGTGGTTGATGATGGAAACTGG - Intronic
1120762068 14:88293978-88294000 GGGTGGATGAGAATGGAAGCAGG - Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122600449 14:102918835-102918857 TTTTGGATGTAGATGGATGGTGG - Intergenic
1122600881 14:102921203-102921225 TTGTGGATGGAGATGGACGGTGG - Intergenic
1122916093 14:104859653-104859675 TGGAGGATGGAGATGGAAGGTGG - Intergenic
1124103770 15:26718726-26718748 TTGTGGAGGATGATGGATGGTGG - Intronic
1124200684 15:27676582-27676604 TTGTGCATGAGGCTGGGAGCAGG - Intergenic
1124353690 15:28979117-28979139 GTGTGGATGGAGATGGCTGCAGG - Intronic
1126808932 15:52381275-52381297 TTCTGGAAGAAGTGGGAAGCAGG - Intronic
1127214366 15:56809270-56809292 TTGGGGAAGAAGGTGGAAGTTGG - Intronic
1127997489 15:64162113-64162135 TTGGAGATGAAGATGTAGGCCGG - Exonic
1129257033 15:74339476-74339498 TGGTGGAGGAGGTTGGAAGCAGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1131472408 15:92708607-92708629 TTGAAGTTGAAGAGGGAAGCAGG - Intronic
1131524910 15:93145029-93145051 GAGTGGATGAAGATGTCAGCCGG + Intergenic
1131898400 15:97059927-97059949 TTGGGGATGAGGATGGTAGTGGG - Intergenic
1132448341 15:101950362-101950384 TTGGGGATGGGGATGGAAGTGGG + Intergenic
1133808613 16:9144339-9144361 TTGAGGGTGAGGATGGAAGGCGG + Intergenic
1134266777 16:12699827-12699849 TTGGGGGTGACGATGGCAGCTGG - Intronic
1134871667 16:17657508-17657530 ACGTGGATGAAGAGAGAAGCTGG + Intergenic
1136620144 16:31423230-31423252 TTGTGGATAAAGTTGGAAGTTGG + Intronic
1136667166 16:31821921-31821943 TTGTAGATGAAGATAGCATCAGG - Intergenic
1139277082 16:65737944-65737966 TTGTGCCTGAACATGGAGGCTGG - Intergenic
1140493934 16:75366758-75366780 CTGGGGCTGAAGATGGGAGCAGG + Intronic
1140569293 16:76084528-76084550 GTGGGGATGAAGATGGGAGAGGG - Intergenic
1141747379 16:85934757-85934779 TCCTGGATGAGGATGCAAGCTGG - Intergenic
1143424031 17:6818749-6818771 TTGTGGTTTAAGTTGGCAGCTGG - Intronic
1143652711 17:8273756-8273778 TTGTGGATAAAGAAGAAAGATGG - Intergenic
1144343517 17:14330726-14330748 TTGGGAATGAAGCTGGGAGCAGG + Intronic
1145933359 17:28701264-28701286 TTCTGGGTGAAGACGGAAGAGGG + Intronic
1146338354 17:31995677-31995699 TTGTGGACGGAGAGGTAAGCAGG - Exonic
1146529891 17:33599526-33599548 TTGTGTATGTAGATGACAGCTGG + Intronic
1146995959 17:37321322-37321344 TTGTGAATGAAAATGAAATCTGG + Intronic
1147056559 17:37839473-37839495 TTATGGCTGAAGAAGGAACCAGG - Intergenic
1147180987 17:38685636-38685658 GGGTGGAAGCAGATGGAAGCGGG - Intergenic
1148130154 17:45257431-45257453 TGGGGGATGGAGATGGAACCGGG - Intronic
1150007899 17:61480820-61480842 TTGTGGATGTAGGTGGGGGCTGG + Intronic
1153679284 18:7485043-7485065 TTGTGGATGAGGCAGAAAGCAGG + Intergenic
1154564308 18:15873490-15873512 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
1154568132 18:15926091-15926113 TTGAGGATAACGTTGGAAGCTGG + Intergenic
1154673290 18:17367128-17367150 TTGTGGATTTCGCTGGAAGCGGG + Intergenic
1154677704 18:17427354-17427376 TTGTGGATTTCGCTGGAAGCGGG + Intergenic
1154702913 18:17773080-17773102 TTGAGGATTTCGATGGAAGCGGG + Intergenic
1154703942 18:17787324-17787346 TTGAGGATTACGTTGGAAGCTGG + Intergenic
1154717441 18:17972377-17972399 TTGAGGATTACGTTGGAAGCTGG + Intergenic
1154767167 18:18654039-18654061 TTGAGGATAACGTTGGAAGCTGG + Intergenic
1154770819 18:18703912-18703934 TTGAGGATTACGTTGGAAGCGGG + Intergenic
1154775190 18:18763967-18763989 TTGTGGATTTCGCTGGAAGCGGG + Intergenic
1154816715 18:19334597-19334619 TTGAGGATTACGTTGGAAGCGGG + Intergenic
1154858855 18:19916351-19916373 TTGAGGATTACGTTGGAAGCGGG + Intergenic
1154908583 18:20612724-20612746 TTGTGGATTTCGATGGAAACGGG + Intergenic
1154910980 18:20650492-20650514 TTGTGGATGTCGTTGGAAACGGG + Intergenic
1154921610 18:20815157-20815179 TTGTGGATTTCGATGGAAACGGG - Intergenic
1154923332 18:20842471-20842493 TTGTGGATGTCGTTGGAAACGGG + Intergenic
1154923538 18:20845874-20845896 TTGTGGATGTCGTTGGAAACGGG + Intergenic
1154923744 18:20849276-20849298 TTGTGGATGTCGTTGGAAACGGG + Intergenic
1154923996 18:20853162-20853184 TTGTGGATGTCGTTGGAAACGGG + Intergenic
1154924201 18:20856564-20856586 TTGTGGATGTCGTTGGAAACGGG + Intergenic
1154924269 18:20857587-20857609 TTGTGGATGTCGTTGGAAACGGG + Intergenic
1154924433 18:20860140-20860162 TTGTGGATGTCGTTGGAAACGGG + Intergenic
1154925095 18:20920558-20920580 TTGTGGATGTCGTTGGAAACGGG + Intergenic
1156061339 18:33080127-33080149 ATGTGGATGGAGCTGGAGGCTGG + Intronic
1156873260 18:41973762-41973784 TTCTGTATGAAAATGGAAGCAGG - Intronic
1157710551 18:49847076-49847098 CTGGGGATGGAGATGGGAGCGGG + Intronic
1158425929 18:57339572-57339594 TTCAGGAGGAAGATGGAAGTGGG + Intergenic
1158903756 18:61990952-61990974 TTGTGGAAGAACTTGGAAGATGG - Intergenic
1158949897 18:62484506-62484528 ACGTGGAAGAAGATGGAATCAGG - Intergenic
1159921387 18:74230302-74230324 ATGGGGTTGAAGCTGGAAGCCGG - Intergenic
1160124266 18:76155895-76155917 ATGGGGATGAACATGCAAGCAGG - Intergenic
1160636926 19:82191-82213 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1160701391 19:509034-509056 TTGCGGATTAAGTTGGAGGCTGG + Intronic
1161652821 19:5495898-5495920 TTGTGGAAGAAGATGGAGCCAGG + Intergenic
1165810167 19:38607258-38607280 TTGTATAAGAAGATGGAAGGAGG + Intronic
1166167765 19:41004247-41004269 TTGTAGAAGAAGTTGGAAGAAGG - Intronic
1166200022 19:41231335-41231357 TTGTGGATGTGGGTGGAAGGAGG - Intronic
1166469739 19:43069409-43069431 TTGAGGAGGAAGAATGAAGCTGG + Intronic
1167254692 19:48419986-48420008 TTGTGGATGAAGAAAGAACACGG + Intronic
925692019 2:6535146-6535168 TTATGGAGGAAAATGGCAGCAGG - Intergenic
925804925 2:7639392-7639414 TTGATGATGAAGATGGTATCAGG - Intergenic
925827509 2:7863900-7863922 TTGGGGCTGAAGATGGAATTTGG + Intergenic
925886907 2:8401288-8401310 TTGGGAATGAAGATGGGAGGAGG + Intergenic
925971313 2:9108419-9108441 TTGTGGTTGCAGATTGGAGCTGG - Intergenic
926831885 2:16972110-16972132 TTGTAGAGGAAGCTGGAAACTGG + Intergenic
928429418 2:31205408-31205430 TTTCCGATGCAGATGGAAGCTGG - Exonic
930173046 2:48271104-48271126 TTCTGAATGAAGATGAAAGTGGG - Intergenic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
932727251 2:74189988-74190010 TTGTGGATGAACATGGATTTTGG + Intergenic
932835222 2:75029654-75029676 TTGTGGGTGAGAATGGAAACAGG - Intergenic
932948435 2:76264945-76264967 TTGTGGAGGAAGATCAAAGAAGG + Intergenic
934349137 2:92394939-92394961 TTGAGGATTAAGTTGGAAACGGG + Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
935275650 2:101473876-101473898 TTTTGGATGTACATGGAAGCAGG + Intronic
935635830 2:105248979-105249001 CTGTGGAAGAAGATGGGAGCTGG + Intergenic
936564550 2:113572850-113572872 TTGGGGATGGGGATGGAAGTGGG + Intergenic
936846117 2:116835629-116835651 TTGTGGATGAAGAATGATGGAGG - Intergenic
938572232 2:132571100-132571122 GTGGGGATGAAGGTGGAAGTGGG - Intronic
938693130 2:133810701-133810723 GTGTGGATGAAAAGGAAAGCAGG + Intergenic
939246270 2:139627152-139627174 TTGTGCATGAAAAAGGAGGCTGG + Intergenic
939448304 2:142337888-142337910 TGGGAGATGAAGAGGGAAGCAGG - Intergenic
940651017 2:156440928-156440950 TTCAGGATGGAGATGGGAGCTGG + Intronic
942461103 2:176169489-176169511 TGGTGGGTGAAGATGGGGGCAGG - Exonic
943473809 2:188329700-188329722 ATGGGGACAAAGATGGAAGCAGG + Intronic
944273501 2:197808931-197808953 TGGGGGATGAAGATGGGAGTTGG + Intronic
945350127 2:208767547-208767569 TTGTGTCTGAAAATGGAAGGAGG - Intronic
945973639 2:216254023-216254045 TTATGGATGAAAAGAGAAGCAGG - Intergenic
946075710 2:217071941-217071963 TGGAGGATGAAGATGGAACAGGG + Intergenic
946679608 2:222199545-222199567 TTAGAGATGAAGATGGAACCGGG + Intergenic
948394604 2:237635417-237635439 GTGGGGATGGAGGTGGAAGCAGG + Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1172112141 20:32553254-32553276 TTGGGGGTGAGGGTGGAAGCTGG - Intronic
1172896285 20:38302634-38302656 TAGTTGCTGCAGATGGAAGCAGG + Intronic
1173136949 20:40447133-40447155 TCCTGGAGGATGATGGAAGCAGG + Intergenic
1173146016 20:40524949-40524971 ATGTGCATGAAGAAGAAAGCAGG - Intergenic
1173895757 20:46549598-46549620 TTGTGGGTGAAGAAGGGAGTTGG + Intronic
1175460885 20:59151145-59151167 GTGTGGATGAAGATGCGAGGGGG + Intergenic
1177756248 21:25351497-25351519 TTGAGGATGAATATAAAAGCAGG - Intergenic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179082401 21:38183995-38184017 TTGTGGAGGAAGATGCAGGAAGG - Intronic
1180237820 21:46474926-46474948 TTGTGGAGGAGGATGGGAGGTGG + Intronic
1180503317 22:15960649-15960671 TTGTGGATTTCGATGGAAACAGG - Intergenic
1182726505 22:32451161-32451183 ACGTGGATGAAGCTGGAAACAGG - Intronic
1203335258 22_KI270739v1_random:61863-61885 TTGTGGATTTCGATGGAAACAGG + Intergenic
949304549 3:2625178-2625200 TGGAGGATGAAGATGGCAGTGGG - Intronic
950176349 3:10877552-10877574 TTGTGGCTGATCATGGAGGCAGG - Intronic
950768144 3:15289412-15289434 TTGTGGTTGAAGATGGCTCCAGG - Intronic
952531647 3:34268539-34268561 ATGTGGATGGAGATGGTTGCTGG - Intergenic
953411972 3:42695749-42695771 GTGTGGATGCAGAGGAAAGCAGG - Intronic
953956449 3:47235538-47235560 TTGTAGAAGGAGATGGAATCAGG + Exonic
954772448 3:52984036-52984058 ATGTGGAGGAAGATGTAAGATGG + Intronic
955235247 3:57133619-57133641 TTGTGGGTGAAGAAGGCAGTGGG + Intronic
955830027 3:62991455-62991477 TTATGGATGAAGATAGAAATTGG + Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957752192 3:84435151-84435173 TTGGGGATGAAGATCTAAGTGGG + Intergenic
957980246 3:87500180-87500202 GTGTGGGTGGAGGTGGAAGCTGG - Intergenic
959816322 3:110677346-110677368 TTGAGGATGAAGGTGGGAGGAGG + Intergenic
960182945 3:114604296-114604318 TTGTGTAAGAAGGTGGAAGGAGG + Intronic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961264120 3:125626626-125626648 TTTTCGATGATGATGAAAGCAGG + Intergenic
961316121 3:126036792-126036814 TACTGGATTAAGATGGAAGATGG + Intronic
961796881 3:129415494-129415516 TTGAGGATGAAACTGGAAGCAGG - Intronic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
964029700 3:152123006-152123028 TTACGTATGAAGAAGGAAGCAGG - Intergenic
966200846 3:177358769-177358791 GTGTGGGTGAAGGTGGAAGTGGG + Intergenic
966354879 3:179069304-179069326 TTATGGATAAAGATTGAAGAGGG - Intronic
966394525 3:179488472-179488494 CTCTGGTTGAAGCTGGAAGCAGG - Intergenic
967592350 3:191293690-191293712 TAGTGGATGAGCATGGCAGCAGG + Intronic
968290358 3:197534244-197534266 TTGTGGTTAAAGATGGAGCCGGG - Intronic
970737251 4:19187583-19187605 AGATGGATGAGGATGGAAGCTGG + Intergenic
971164757 4:24171420-24171442 TTGTAGATGAAGATGGGCACGGG - Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
972006891 4:34120639-34120661 TTGTGCATTAAGATTGATGCTGG + Intergenic
973404303 4:49708350-49708372 TTGTGGATTACGTTGGAAACGGG - Intergenic
973447714 4:50427001-50427023 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
973452839 4:50511833-50511855 TTGTGGATTACGTTGGAAACGGG + Intergenic
973471333 4:50816194-50816216 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
973491316 4:51146226-51146248 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
973495215 4:51210689-51210711 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
973504444 4:51363062-51363084 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
974677414 4:65111443-65111465 TTGTTGACGAACAAGGAAGCAGG + Intergenic
977132662 4:93262006-93262028 TTGTGGAAGAAGCCAGAAGCTGG - Intronic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
977565918 4:98580477-98580499 CTGTGAAGGAAGATTGAAGCTGG - Intronic
981616389 4:146648362-146648384 TTGTGGACGAGGAAGGAAGGTGG + Intergenic
983254004 4:165378696-165378718 TGGTGGATCAAGATGGAAACTGG + Intronic
984623120 4:181975736-181975758 TTGTGGATAAATATGGAAGCCGG + Intergenic
985200863 4:187484181-187484203 TTGTGGAGGAAAAACGAAGCAGG + Intergenic
985843495 5:2327208-2327230 TTGTGGGTGAAGATGGAACTGGG - Intergenic
986040290 5:3987750-3987772 TTGTGGATGCAGCTTGAAGCAGG - Intergenic
986615099 5:9608202-9608224 TTCTGACTGAAGTTGGAAGCAGG + Intergenic
989078212 5:37587433-37587455 ATGGGGATGAAAATGGAAACGGG - Intronic
990615832 5:57507412-57507434 TTGTGAATGGAGATGAAGGCAGG + Intergenic
990906861 5:60813118-60813140 TGTTGGTTGAAGATAGAAGCTGG - Intronic
993031552 5:82712436-82712458 TTTTGGATGAGTATGGAAGGAGG + Intergenic
993055037 5:82971395-82971417 TTGTGTTGGGAGATGGAAGCTGG + Intergenic
995571326 5:113485577-113485599 TTGGGGATGAAGAGGGAGACAGG + Intronic
996706808 5:126506184-126506206 TTGTTTGTGAAGTTGGAAGCAGG - Intergenic
996945783 5:129065939-129065961 TTGGCCATGAAGATGGAGGCAGG + Intergenic
997263005 5:132478077-132478099 TTGTGGATGCTGAGGGAAGGCGG - Intergenic
998006917 5:138663177-138663199 ATGAGGATGGAGATGGCAGCTGG - Intronic
998523899 5:142825301-142825323 TTGTGGAGGAAGAGGGTAGTTGG + Intronic
998624898 5:143835313-143835335 CTCTGGATGATGTTGGAAGCCGG + Intergenic
999252524 5:150190947-150190969 TGATCAATGAAGATGGAAGCTGG + Intronic
1000161388 5:158600954-158600976 TTGTGTATGAAGACAGAGGCTGG - Intergenic
1000841198 5:166220627-166220649 TTGTCTATGAACAAGGAAGCAGG - Intergenic
1001338128 5:170818042-170818064 TTGTGGTTGAAGAATGATGCAGG + Intergenic
1002850909 6:995645-995667 TTGAGGATGGAGAGGGAAGGAGG - Intergenic
1003255877 6:4474506-4474528 TTGTGGGTGGAGATGTCAGCAGG - Intergenic
1003309385 6:4956203-4956225 TTGTGCAAGAAGTTGGAAGGTGG - Intergenic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1005591581 6:27334348-27334370 TTTTGGATGATGATGGAACATGG + Intergenic
1005650542 6:27880989-27881011 TTGTGGATGAAGACCAAAGAGGG - Intergenic
1005734061 6:28729047-28729069 TTGTGAATGGAGCTTGAAGCAGG + Intergenic
1006683238 6:35812263-35812285 TTGTAGAACAAGCTGGAAGCAGG + Intronic
1007091288 6:39186309-39186331 TTGTGCATGAATTTGGAAACCGG + Intergenic
1008874244 6:56308243-56308265 AGATGGAAGAAGATGGAAGCTGG - Intronic
1008923018 6:56862494-56862516 TGGTGGATGAAGATCACAGCAGG + Intronic
1009428425 6:63540141-63540163 TTGAGGATGATGATGGAATCTGG + Intronic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1012233318 6:96785246-96785268 ATGGGTCTGAAGATGGAAGCTGG + Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1013764526 6:113559212-113559234 TTGGGCATGAAGAAGGAAGTGGG + Intergenic
1014059431 6:117053096-117053118 TTGTGGAGGGAGATGGGAGAGGG + Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1017115884 6:150975935-150975957 TTGTGGCTTAAGGGGGAAGCGGG + Intronic
1017412113 6:154178884-154178906 TTGTGGATGATTCTGGAATCAGG - Intronic
1019326985 7:443359-443381 TGGTGGATGGAGATGGATGGAGG + Intergenic
1019555923 7:1631284-1631306 ATGTGGAAGAAGATAGAAGGAGG - Intergenic
1019706610 7:2499967-2499989 TTGGGGAGGAAGGTGGAAGCTGG + Intergenic
1019798088 7:3066966-3066988 TTGGGGTTGGAGATGGAAGGGGG - Intergenic
1020495477 7:8846267-8846289 TTGTGGAGGAAGCTTGATGCTGG - Intergenic
1021983709 7:26079412-26079434 TTGGGGATGATGATGGGAGCTGG - Intergenic
1022953073 7:35356631-35356653 GAGTGGATGAAGACGGAAACTGG + Intergenic
1023027456 7:36063628-36063650 CTGTGGATGGAGCAGGAAGCAGG + Intergenic
1024701329 7:51907155-51907177 TTGTGGCTGAGGCTGGAGGCTGG - Intergenic
1026124689 7:67569273-67569295 TTGTGGATGCACTTGGAAGAGGG - Intergenic
1026803149 7:73412420-73412442 TCTTTGATGAAGATGGCAGCAGG - Intergenic
1028107213 7:86892988-86893010 TTTTGGCTGAAGGTGGGAGCCGG - Exonic
1028334082 7:89629473-89629495 TAGTGGTGGGAGATGGAAGCTGG - Intergenic
1028583934 7:92434696-92434718 TTGTCTTTGAAGATGGAAGAAGG + Intergenic
1028952254 7:96649747-96649769 ATGTGGAAGAACATGGGAGCAGG - Intronic
1030101267 7:105947532-105947554 TTGTGGATATAGTTGGAAGTAGG - Intronic
1030928901 7:115497433-115497455 TTGTGGAAGAAGGTGGCAGCTGG + Intergenic
1032192647 7:129773474-129773496 GTGTGGTTGAAGCTGGCAGCTGG - Intergenic
1035113017 7:156500228-156500250 ATTTGGAAGAAGATGGAAGAAGG + Intergenic
1036409854 8:8489348-8489370 TTGTGGCTCAAGATGAAAGTAGG - Intergenic
1036613249 8:10367961-10367983 TTGTGGGTGAAGATGGCAATGGG + Intronic
1036733836 8:11289611-11289633 TTGTGGATGAGGCAGGAAACGGG - Intronic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1039459130 8:37728759-37728781 TTCTGGAAGAAGATAGAAGATGG - Intergenic
1039830299 8:41208094-41208116 TTGAGGATGAAGAAGGAGACAGG - Intergenic
1039842205 8:41302277-41302299 TTGTGGATGAAGATGGAAGCTGG - Intronic
1039954217 8:42195022-42195044 TTGTGGATGAAGGAGGGAACAGG - Intronic
1040391994 8:46958045-46958067 TTGTGGAAGAAGATGAGAGTGGG - Intergenic
1041639140 8:60178173-60178195 TTGTTGATGAAAATGGCTGCAGG - Intergenic
1043636506 8:82390784-82390806 TTGTGGAAGAAGAAGAAGGCTGG + Intergenic
1043880239 8:85534406-85534428 TTGTGGATGTAGCTGCAAGTTGG - Intergenic
1045358755 8:101412949-101412971 TGGTGGATTAAGAAGGAAGAGGG - Intergenic
1047064610 8:121266849-121266871 TTGTCAATGCAAATGGAAGCAGG - Intergenic
1047307641 8:123665994-123666016 CCATGGATGAAGATGGAACCTGG + Intergenic
1047389295 8:124437149-124437171 TCCTGGCTGAAGAGGGAAGCAGG + Intergenic
1047470344 8:125165295-125165317 TTGTGCATGAAGATGAAAAGAGG - Intronic
1048427722 8:134338377-134338399 TTGTGGCTGGAGTTGGAAGTGGG - Intergenic
1048445728 8:134491631-134491653 TTGGCTTTGAAGATGGAAGCAGG - Intronic
1049405146 8:142449069-142449091 TGGTGGGTGTAGATGGAAGTGGG - Intergenic
1049887870 9:40364-40386 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1050628946 9:7538555-7538577 TTGAGAGTGAAGATGGAGGCAGG + Intergenic
1051061587 9:13051583-13051605 ATTTGGATGAAGAGGGAAGGAGG + Intergenic
1052054483 9:23888113-23888135 TTGAGGAAGAAGCTGGGAGCTGG + Intergenic
1055202642 9:73685079-73685101 TTGGTGATGTAGATGCAAGCTGG - Intergenic
1056241976 9:84656809-84656831 GTGTGGAAGAAGATGGAAGGTGG + Intergenic
1057422614 9:94924653-94924675 TAGTGAATGAAGAATGAAGCAGG + Intronic
1057878367 9:98774591-98774613 TTGGGAGTGAAGAAGGAAGCAGG + Intronic
1058634242 9:107020929-107020951 TTAAGTATGAAGATGGAAGATGG + Intergenic
1059979830 9:119759354-119759376 TTGGGCAGGAAGATGGAAGGAGG + Intergenic
1061058355 9:128236940-128236962 TTTAGGATAAAGATGGAATCTGG - Intronic
1062218270 9:135400682-135400704 TTGTGGATGCAAAGGGAGGCCGG + Intergenic
1203354924 Un_KI270442v1:127042-127064 TTGAGGATTTAGATGGAAACGGG - Intergenic
1185934009 X:4235286-4235308 TTGGGGAGAAGGATGGAAGCGGG - Intergenic
1187334885 X:18373351-18373373 TTGGGGATGAAGAGGAAAACTGG - Intergenic
1187770798 X:22693352-22693374 TTGTTGATAAATATTGAAGCTGG - Intergenic
1189542973 X:42011844-42011866 ACGTGGATGAAGGTGGAGGCAGG + Intergenic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190388648 X:49910297-49910319 TGGAGGATGAAACTGGAAGCGGG - Intergenic
1190831560 X:54063492-54063514 TTGTGGATGAGGAAAGAATCTGG + Intergenic
1194889502 X:99361049-99361071 TAGTGGATAAAGATCTAAGCAGG + Intergenic
1195907472 X:109859345-109859367 TTGTAGAAGAAGGTGGAAGTAGG + Intergenic
1197347985 X:125347219-125347241 TTGTGGATGGAGATGCAAAATGG + Intergenic
1198738639 X:139816305-139816327 TTGCAGATGAAAATGGAAACAGG - Intronic
1199266655 X:145835738-145835760 CTGTGGTTGAACATAGAAGCAGG - Intergenic
1201638598 Y:16153760-16153782 TTGTGGATAAAGAAGAAGGCAGG - Intergenic