ID: 1039842862

View in Genome Browser
Species Human (GRCh38)
Location 8:41306509-41306531
Sequence GTCCCTGTGGAGGGGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 7, 3: 63, 4: 514}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039842862_1039842872 -3 Left 1039842862 8:41306509-41306531 CCCACCCTCCCCTCCACAGGGAC 0: 1
1: 0
2: 7
3: 63
4: 514
Right 1039842872 8:41306529-41306551 GACCTCGCAGGAAATCACGTGGG No data
1039842862_1039842873 -2 Left 1039842862 8:41306509-41306531 CCCACCCTCCCCTCCACAGGGAC 0: 1
1: 0
2: 7
3: 63
4: 514
Right 1039842873 8:41306530-41306552 ACCTCGCAGGAAATCACGTGGGG No data
1039842862_1039842879 27 Left 1039842862 8:41306509-41306531 CCCACCCTCCCCTCCACAGGGAC 0: 1
1: 0
2: 7
3: 63
4: 514
Right 1039842879 8:41306559-41306581 TACACCAGGGATTGCAGTCCTGG No data
1039842862_1039842871 -4 Left 1039842862 8:41306509-41306531 CCCACCCTCCCCTCCACAGGGAC 0: 1
1: 0
2: 7
3: 63
4: 514
Right 1039842871 8:41306528-41306550 GGACCTCGCAGGAAATCACGTGG No data
1039842862_1039842875 13 Left 1039842862 8:41306509-41306531 CCCACCCTCCCCTCCACAGGGAC 0: 1
1: 0
2: 7
3: 63
4: 514
Right 1039842875 8:41306545-41306567 ACGTGGGGCTCCCTTACACCAGG No data
1039842862_1039842876 14 Left 1039842862 8:41306509-41306531 CCCACCCTCCCCTCCACAGGGAC 0: 1
1: 0
2: 7
3: 63
4: 514
Right 1039842876 8:41306546-41306568 CGTGGGGCTCCCTTACACCAGGG No data
1039842862_1039842880 28 Left 1039842862 8:41306509-41306531 CCCACCCTCCCCTCCACAGGGAC 0: 1
1: 0
2: 7
3: 63
4: 514
Right 1039842880 8:41306560-41306582 ACACCAGGGATTGCAGTCCTGGG No data
1039842862_1039842881 29 Left 1039842862 8:41306509-41306531 CCCACCCTCCCCTCCACAGGGAC 0: 1
1: 0
2: 7
3: 63
4: 514
Right 1039842881 8:41306561-41306583 CACCAGGGATTGCAGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039842862 Original CRISPR GTCCCTGTGGAGGGGAGGGT GGG (reversed) Intronic
900119041 1:1040899-1040921 GTGCCTGGGGCGGGGAGGGGCGG + Intronic
900255667 1:1697273-1697295 GCCCCTGCGGAGAGCAGGGTGGG - Intronic
900264337 1:1749896-1749918 GCCCCTGCGGAGAGCAGGGTGGG - Intergenic
900326466 1:2110800-2110822 GTCCCTGTGGGGGGCAGGGCTGG + Intronic
900375082 1:2350564-2350586 GTCCCTGGGGTGGGGATGGCTGG + Intronic
900387214 1:2416182-2416204 GACCCCGAGGAGGGCAGGGTGGG + Intergenic
900547656 1:3237440-3237462 GTTGCTGTGGAAGGCAGGGTGGG + Intronic
902218555 1:14950144-14950166 AACCCTGTGGAGGAGTGGGTGGG + Intronic
902283043 1:15388327-15388349 GGGCCTGGGGAGGGGAGGGAGGG - Intronic
902333504 1:15742427-15742449 GGCCCAGGGGAGGGGAGGGGAGG - Exonic
902368669 1:15992573-15992595 GGCCCTTTGAAGGGGAGAGTGGG - Intergenic
902375017 1:16026517-16026539 GGCCCTGCAGAGGGAAGGGTGGG - Exonic
902701832 1:18177720-18177742 GACCCTGTGGAAGGGGGAGTGGG + Intronic
902807686 1:18871392-18871414 GTCTTTCTGGAGGGGATGGTGGG - Intronic
902931792 1:19736596-19736618 CTGCCTGTGGAGGGGCTGGTTGG - Intronic
903005885 1:20298487-20298509 TGCCCTGTGTAGGGGAAGGTGGG - Intronic
903540349 1:24093105-24093127 CTCCCTGTGGAGGGGAAGTGGGG + Exonic
903607259 1:24584130-24584152 GTCCCTGTGGGGCGGGGGGAGGG - Intronic
903664804 1:24999759-24999781 GTCTCTGTGGAAGGGCTGGTCGG - Intergenic
903697059 1:25215556-25215578 GTCCCTGTGGATGGGGTTGTTGG - Intergenic
903814448 1:26054432-26054454 TAGCCTGTGGAGGGGAGGGGTGG + Intronic
904609709 1:31718741-31718763 GTGCCTGTGGTGGGGTGGGGAGG - Intergenic
904883925 1:33721607-33721629 GTTCCTAAGGAGGGGAGGGCTGG - Intronic
905241674 1:36585618-36585640 GGACCTGTGGAGGTGGGGGTGGG + Intergenic
905309071 1:37037061-37037083 CTCCCGGTCTAGGGGAGGGTGGG + Intergenic
905651918 1:39662342-39662364 GGCCCTGTTGAGGGTAGGGGTGG - Intronic
905770397 1:40634313-40634335 CTCCCTGTGGGGTGGAGGCTGGG - Intronic
905775125 1:40663461-40663483 GTCCCTGGGGAGGGGGGAGCAGG - Intronic
905777609 1:40679287-40679309 GTGCCTGGGGAGGGGATGGTGGG - Intergenic
905893232 1:41529912-41529934 GTCCGTGTGGTGGGGGGTGTTGG - Intronic
906076959 1:43058849-43058871 GGCCCTTTGGAGGAGAGGGCAGG + Intergenic
906126292 1:43428891-43428913 GTCCCTGTTGAAGGGAGGAAGGG + Intronic
906814712 1:48867021-48867043 CTGCCTGTGGAGCAGAGGGTAGG + Intronic
907544450 1:55247269-55247291 GTCCCTGTGGATGGAAGACTTGG - Intergenic
908128054 1:61050229-61050251 GCCCCTGGAGAGGGGAGGGCAGG - Intronic
909365089 1:74811636-74811658 GTCACTGTGGAGGGCAAGGAAGG - Intergenic
914004048 1:143717421-143717443 GGCTCTGAGGATGGGAGGGTTGG - Intergenic
914006740 1:143738688-143738710 GTCACAGGGAAGGGGAGGGTAGG + Intergenic
914095271 1:144539779-144539801 GGCTCTGAGGATGGGAGGGTTGG - Intergenic
914303252 1:146394117-146394139 GGCTCTGAGGATGGGAGGGTTGG + Intergenic
914339404 1:146746208-146746230 GTCCATGGGCAGGGGAGGGCAGG - Intergenic
915090516 1:153420954-153420976 GTCCCGGTGGAGGAGAGAGGAGG - Exonic
915284136 1:154842208-154842230 ATCACTGTGGAGGCCAGGGTGGG - Intronic
915318220 1:155041623-155041645 ATCCCTGGGGAGTGGAGGGTGGG + Intronic
915510010 1:156381728-156381750 GTCACTGTGGTGTGTAGGGTTGG + Intronic
915557324 1:156667940-156667962 GTCCCTGTGTAGGACAGGGAGGG - Intergenic
915902532 1:159856698-159856720 GTCCCTGTGGGGTGGGGGATGGG + Intronic
916045193 1:160994653-160994675 GATCCTGGGGAGGGGAGGTTGGG - Intergenic
916572335 1:166038766-166038788 GTCCCTGTGGAGGGCATGGTGGG - Intergenic
917497088 1:175550330-175550352 CCTCCTGTGGAGGTGAGGGTTGG - Intronic
917669141 1:177256302-177256324 TTCCCTGAGGAGGGGAAGTTGGG + Intronic
918243696 1:182641339-182641361 GGTCCTGTGGAGGGGATGGAAGG - Intergenic
918641013 1:186841422-186841444 GTGCATGTGGGGGGCAGGGTGGG + Intronic
918830150 1:189385433-189385455 GTTCCTGTGGAGAGTAAGGTAGG + Intergenic
919821595 1:201476479-201476501 GGACCTGTGGATTGGAGGGTGGG - Intergenic
920364329 1:205440164-205440186 GTCCCTGAGGAGGGGAGTCAGGG + Intronic
921100423 1:211924097-211924119 GTGCCTGTGGAGGTGAGGGGTGG - Intergenic
921937088 1:220805129-220805151 GTCCCTGTGGGGTGGAGGTGGGG + Intronic
922570563 1:226632320-226632342 GTCCCTGTGGTGACGAGGGCTGG + Exonic
922787834 1:228291987-228292009 GCCCCTGTGGAGTGGAGGAAGGG + Exonic
922788962 1:228299348-228299370 GCCCCTGTGGAGTGGAGGAAAGG + Exonic
922789656 1:228304392-228304414 GCCCCTGTGGAGTGGAGGAAGGG + Exonic
923299913 1:232630771-232630793 GGCCCTGTGGGTCGGAGGGTGGG + Intergenic
923340923 1:233006361-233006383 GTGCATGTAGAGGGGAGGCTGGG + Intronic
923538306 1:234869971-234869993 GTGCGTGTGGAACGGAGGGTTGG - Intergenic
923660668 1:235954611-235954633 ACCCCAGTGGAGGGAAGGGTGGG + Intergenic
924947492 1:248856174-248856196 GTTAGTGTGGAGGGAAGGGTGGG - Intronic
1062822888 10:548205-548227 TTTCCTGTGGGGGGGGGGGTGGG - Intronic
1063385407 10:5613497-5613519 TTCCCGGTGGAGGGTGGGGTAGG - Intergenic
1063434155 10:6017271-6017293 GCTTCTGTGGACGGGAGGGTGGG + Intronic
1064304312 10:14151730-14151752 TTCCCTGGGGAAGGGAGGGAGGG - Intronic
1066476477 10:35751911-35751933 GTGTCTGTGGAGGGGAGTGGTGG + Intergenic
1067173128 10:43923721-43923743 GTCCCTTAGGACGGGAGGTTAGG - Intergenic
1067279638 10:44861462-44861484 ATGCCTGTGGAGGGGTGGGGTGG - Intergenic
1067557493 10:47282955-47282977 GTCCCTGTGCAGGCCACGGTGGG + Intergenic
1067699043 10:48555617-48555639 GTCCCTGGAGAGGAGAGGTTAGG + Intronic
1067709305 10:48635652-48635674 GTCCCTGTGGAAGTGAGTCTTGG + Intronic
1067905425 10:50286079-50286101 GTGTGTGTGGAGGGGAGGGTGGG - Intergenic
1068485483 10:57653507-57653529 GTGAGTGTGTAGGGGAGGGTGGG - Intergenic
1069718906 10:70537954-70537976 GTCACTGCGGTGGGGAGGCTGGG - Intronic
1071816098 10:89233958-89233980 CTCCCTGTGGGAGGGAGTGTGGG - Intronic
1073075581 10:100824142-100824164 GTCCCTGTAGGGGTGATGGTGGG + Intronic
1073149966 10:101304916-101304938 GTCATTGTAGAGGGGAGGATAGG + Intergenic
1073243030 10:102070564-102070586 GTCCCTGGGAAGGTGAGGGGAGG + Intergenic
1073889959 10:108090306-108090328 GTCCCTGGGGTGGGGTGGGAGGG - Intergenic
1074395762 10:113096830-113096852 CTCCCTCCAGAGGGGAGGGTGGG + Intronic
1074772202 10:116741839-116741861 GTCCCTGGGGATGGGCGGGGAGG + Intronic
1075340250 10:121641917-121641939 GTCACAGAGCAGGGGAGGGTTGG - Intergenic
1075981682 10:126745808-126745830 GTGCCTATGGAGGGCAGGCTTGG - Intergenic
1076215086 10:128686974-128686996 GTGCCTGTGGAAGGAAGGGCAGG + Intergenic
1076743807 10:132502525-132502547 GTGCCTGTGGAGGCTAAGGTGGG - Intergenic
1076778710 10:132711941-132711963 GTCCATGTGGAGGGGTCCGTGGG + Intronic
1077199612 11:1299082-1299104 GTTCCCGGGGAGGGGAGCGTCGG + Intronic
1077299742 11:1841437-1841459 GCTCCTGTGGAGGAGAGGGCAGG - Exonic
1077500283 11:2906925-2906947 GGCGCTGGGGAGGGGAGGGATGG + Intronic
1077902178 11:6498219-6498241 GTCCCGGAGGAGAGGAGGGTAGG + Exonic
1078509626 11:11975759-11975781 GAGCCTGTAGAGGGGAGTGTGGG - Intronic
1078725499 11:13926810-13926832 GTGCCTGTGGCGGGGTGGGGGGG - Intergenic
1081281367 11:41212582-41212604 GGGCCTGTTGAGGGGAGGGGTGG - Intronic
1081809209 11:45905852-45905874 GGCCCAGGGTAGGGGAGGGTGGG + Exonic
1083198760 11:61106740-61106762 AGCCCTGTGGAGGGGAGCTTTGG + Intronic
1083331685 11:61901343-61901365 GTCACTCGGCAGGGGAGGGTGGG + Intronic
1083595303 11:63916087-63916109 GTCCCTGAGGGGGTGAGGGCAGG + Intronic
1083680996 11:64351858-64351880 CGCCCTGTGGAGGGGAGGGCTGG - Intronic
1083725993 11:64628530-64628552 GTCCCTGAGGAGAGGAGAGCAGG + Intronic
1083938449 11:65882514-65882536 GTCTCCGTGCAGGGTAGGGTTGG + Exonic
1083945668 11:65921270-65921292 GCCCCTGTGGAGGGCACGGTGGG + Intronic
1084376573 11:68782283-68782305 GTTCCTGTAGAGGGGAGGGAGGG - Intronic
1084768119 11:71325512-71325534 GGCCCTGTGAAGGGGAGGCAGGG + Intergenic
1085172782 11:74463180-74463202 GACAGTGTGGAGGGTAGGGTGGG + Intronic
1085204091 11:74719940-74719962 GTACCTGCGTAGAGGAGGGTTGG - Intronic
1085567155 11:77524566-77524588 TTCTCTGTGTAGGGGAGGGTTGG + Intronic
1085886336 11:80526729-80526751 GACCCAGAAGAGGGGAGGGTTGG + Intergenic
1086525016 11:87714814-87714836 GTTCCTGTGGTGGCAAGGGTAGG - Intergenic
1087235431 11:95712818-95712840 GTGCCTCTGGAGGGGTGGGAAGG - Intergenic
1089395756 11:118135670-118135692 GACCCTGGGGAGGGGAGGGCTGG + Exonic
1089688256 11:120170265-120170287 GACCCTCTGGAGGGTCGGGTGGG + Exonic
1090244992 11:125209863-125209885 GACCAGGTGGAGGTGAGGGTGGG - Intronic
1090259132 11:125306154-125306176 GTGCCAGTGGCGGGGAGGGAGGG - Intronic
1090286597 11:125505067-125505089 GTCCCCGGGGAGGGGAGGCTGGG + Intergenic
1090482536 11:127080863-127080885 GTCCCTGGGGTGGGGTGGGGTGG + Intergenic
1091115374 11:133007513-133007535 GTTCCTTTGGAAGGCAGGGTGGG + Intronic
1091384020 12:80826-80848 GTCCTGGAGGAGGGGAGGGAGGG + Intronic
1092095046 12:5834785-5834807 TTCCTTTTGGAGAGGAGGGTGGG - Intronic
1092728477 12:11507131-11507153 ATCTCTGTGGAGAGGAGGCTGGG + Intergenic
1092825699 12:12396430-12396452 GGCCCTGCGGAGGGTGGGGTGGG + Intronic
1094233775 12:28139375-28139397 TTCCCTCTTGAGGGAAGGGTTGG - Intronic
1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG + Intergenic
1096251064 12:50032959-50032981 GCCCCTGGGGAGGTGAGGGCCGG - Intronic
1096408201 12:51358896-51358918 ATCCCTTTGGAGGGGAAGGGAGG - Intronic
1096628006 12:52907084-52907106 GGGCCTGGGGAGGGGAGGGGAGG - Intronic
1096633659 12:52945307-52945329 GGCCCTGTGGTGGGGTGGGCTGG - Intronic
1096657543 12:53101022-53101044 GGCCCTGGGGAAGGGAGAGTAGG - Exonic
1096790293 12:54040165-54040187 GTGTCTCTGGAGCGGAGGGTGGG + Intronic
1097052483 12:56231570-56231592 GGCCCTGTGGAGTGGAGGAAGGG - Intronic
1099653688 12:85461743-85461765 TTCCCTGGGTCGGGGAGGGTGGG + Intergenic
1101106839 12:101448847-101448869 GTGCATGTGGCGGGGCGGGTGGG + Intergenic
1101376549 12:104176084-104176106 GTGGCTGTTGAGGGGAAGGTGGG + Intergenic
1101817701 12:108158454-108158476 GTCCCTGGGGCGGGCGGGGTGGG + Intronic
1102022888 12:109696141-109696163 GCCCCTTTGGAGGGGAAGCTGGG + Intergenic
1102819930 12:115899392-115899414 GTCTCTCAGAAGGGGAGGGTAGG - Intergenic
1103856378 12:123973286-123973308 GTCCCTGAGGAGAGGGAGGTGGG + Exonic
1104109140 12:125689086-125689108 GGACCAGGGGAGGGGAGGGTTGG + Intergenic
1104586348 12:130051068-130051090 GGGGCTGTGGAGGGGAGGGGCGG - Intergenic
1104745983 12:131210844-131210866 CTCCCTGGGGAGGGGTGTGTGGG + Intergenic
1104891146 12:132140754-132140776 GTCGGGGTGGAGGTGAGGGTTGG + Intronic
1105404061 13:20119037-20119059 GCCCCTGTGGAAGGGAGGCTGGG + Intergenic
1105790042 13:23789792-23789814 GTGCGGGTAGAGGGGAGGGTGGG - Intronic
1105890885 13:24681346-24681368 GTCCGTGTAGAGGGGAGGCGGGG - Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106350909 13:28929918-28929940 TGACCTGTGGAGGGGAGGGTTGG + Intronic
1107549959 13:41464942-41464964 GCCCCTGGGCAGGAGAGGGTGGG + Intronic
1108083709 13:46763097-46763119 TTCCCAGGGGAGGGGAAGGTGGG - Intergenic
1109336803 13:61004551-61004573 GTTCCTGTGGTGGTGAGGGTGGG + Intergenic
1110400914 13:75091024-75091046 GTCCTTGAGGAGCAGAGGGTAGG - Intergenic
1110510122 13:76340969-76340991 GACCTTGTGGAGGGTGGGGTGGG - Intergenic
1111122824 13:83877676-83877698 GTTGCTGGGGCGGGGAGGGTGGG + Exonic
1111968773 13:94888489-94888511 GTGGCTGTGGATGGGAGGGTTGG - Intergenic
1113379400 13:109787679-109787701 GCCCCTGTGGAAGGAAGGGGGGG - Intergenic
1114082464 14:19213255-19213277 GACCCTGTGGAGGGGGAGGTGGG + Intergenic
1114224160 14:20723341-20723363 TTCCTTGTGGAGGGGCCGGTGGG - Intergenic
1114964902 14:27945252-27945274 GTAGCTGTGGAGGAGAGGGGAGG + Intergenic
1115850661 14:37587898-37587920 GTCCCCGGGGAGGGGAGGGAGGG - Intergenic
1116452819 14:45083932-45083954 GTCCCTATGGAGGGAAAGGCAGG + Intergenic
1117166719 14:53041882-53041904 GTATGTGTGGAGGGGAGGTTGGG + Intronic
1118697271 14:68397444-68397466 ATCCCCGGGGAGTGGAGGGTAGG - Intronic
1118808816 14:69259656-69259678 GTCCTTGTGTAGGGGCGGCTGGG - Intronic
1119180454 14:72601362-72601384 GGTCCTGAGCAGGGGAGGGTTGG - Intergenic
1119182627 14:72614914-72614936 GTGCCTGGGGAAGGGAGGGTGGG - Intergenic
1119479368 14:74950065-74950087 GACTCAGTGGAGAGGAGGGTCGG - Intronic
1119643196 14:76329946-76329968 GTCCTTGGGGAGGTGTGGGTGGG + Intronic
1120917086 14:89719730-89719752 GTATCTGTGGAGAGGAGGGATGG + Intergenic
1121046261 14:90790605-90790627 GTCCCTGTGGCAGGGAGGCGAGG - Intronic
1121426613 14:93856707-93856729 TTCCCTGAGGAGGGGAAGGAGGG + Intergenic
1121681212 14:95794147-95794169 GTGCATGTTGAGGGGAGTGTGGG - Intergenic
1122117323 14:99534418-99534440 GTTCCTGTGGAGAAGTGGGTTGG - Intronic
1122922553 14:104886021-104886043 GGCCCTGTGGAGAGGAGGGTGGG - Exonic
1124061000 15:26293724-26293746 GTGCCACTGGAGTGGAGGGTGGG + Intergenic
1124061553 15:26298152-26298174 CCCACTGTGGAGGGGAGGCTCGG + Intergenic
1124189898 15:27565573-27565595 GTCCCTTGGCAAGGGAGGGTGGG + Intergenic
1124924092 15:34054674-34054696 GAGCCTGTGGGGGTGAGGGTAGG + Intronic
1124959102 15:34381931-34381953 ATCCCTGTGGGGGTGGGGGTGGG - Intronic
1124975728 15:34528152-34528174 ATCCCTGTGGGGGTGGGGGTGGG - Intronic
1125503560 15:40253659-40253681 GTGGCTGTGCAGGGCAGGGTGGG + Intronic
1126691074 15:51289444-51289466 GTCCCTGTGGGTGAGAGTGTGGG - Intronic
1128145318 15:65329548-65329570 GACCCTGTGGAGGGGACAGCTGG + Exonic
1128691173 15:69726017-69726039 GTCCCTGCAGAGGGGCTGGTTGG - Intergenic
1128738074 15:70064741-70064763 GTCCCCAGGGTGGGGAGGGTAGG + Intronic
1128742656 15:70095057-70095079 ATCCCTGAGGAGGGGAGTGGAGG + Intronic
1128772749 15:70294651-70294673 GGCCCTGGGGCGGGAAGGGTTGG + Intergenic
1129172601 15:73817294-73817316 GTCCCTGTGGGGAGGAGGTGCGG - Intergenic
1129278228 15:74461494-74461516 GCCCTTCTGGAGGGAAGGGTCGG - Intergenic
1129683635 15:77672179-77672201 GTCCATGTGGAGGGGAGGTGGGG - Intronic
1129744851 15:78011186-78011208 GTCTCTGTGGTGGTGAGGATAGG - Intronic
1130236772 15:82142479-82142501 GACCCTGTGGGAGGGAGGGATGG + Intronic
1130650623 15:85760256-85760278 GGCTCTGAGGAGGGGAGGGGAGG + Exonic
1130783954 15:87074888-87074910 TTCTCTGTGGAGGAGAGGGAGGG + Intergenic
1131111473 15:89767495-89767517 GGCCCGGTGGGGGGGAGGCTGGG + Intronic
1131165858 15:90141832-90141854 AACTCTGTGGAGGGGAGGGAAGG + Intergenic
1132316952 15:100897408-100897430 GTACCCCTGGAGGGGAGGGCTGG - Intronic
1132550850 16:553296-553318 GGACCTGTGGAGGGCAGGGTGGG - Intronic
1132551236 16:554671-554693 GGCCCTGTGGAAGGGCGGGGAGG + Intergenic
1132661039 16:1061625-1061647 GTCCTCATGGAGGGGTGGGTGGG + Intergenic
1132672618 16:1107970-1107992 GTCCCTGTGACAGGGACGGTTGG + Intergenic
1132674717 16:1116937-1116959 GACCCTGAGTTGGGGAGGGTAGG - Intergenic
1132674754 16:1117028-1117050 GCCCCTGTGGAAAGGAAGGTGGG - Intergenic
1132927365 16:2437940-2437962 GGCCCTCTGCAGGGGAGGGAGGG + Intronic
1132939299 16:2499050-2499072 GTCCCTGCGGTGGGGAGGTTTGG - Intronic
1133814905 16:9189601-9189623 GGGCCTGTGCAGGGGAGGGGAGG - Intergenic
1134061426 16:11201902-11201924 GGCCCTGGGGAGGGGAAGGAGGG + Intergenic
1134083282 16:11339240-11339262 GTCACTGAGTAGGGGAGGGCTGG + Intronic
1135423292 16:22318758-22318780 CTCTCGGTGGAGGGGAGGGAAGG + Intronic
1136081674 16:27856223-27856245 ATCCTTGTGGTGGGGAGGGCAGG + Intronic
1136129583 16:28211581-28211603 TTCCTTGGGGAGGGGCGGGTGGG - Exonic
1136478393 16:30526798-30526820 CTTCCTGTGCGGGGGAGGGTGGG - Intronic
1136923404 16:34350349-34350371 GACCGTGCGGAGCGGAGGGTGGG - Intergenic
1136981169 16:35061457-35061479 GACCGTGCGGAGCGGAGGGTGGG + Intergenic
1137954520 16:52815490-52815512 CTCCTTGGGAAGGGGAGGGTGGG - Intergenic
1138090176 16:54167539-54167561 GTCACAGTGGAGAGAAGGGTTGG + Intergenic
1138200860 16:55087360-55087382 GGCCCTGGGGTAGGGAGGGTGGG + Intergenic
1138230402 16:55331993-55332015 GTCCCTGGGGAGGTTGGGGTTGG - Intergenic
1138460048 16:57142692-57142714 GTCCCAGTGGAGGGGGAGCTGGG + Intronic
1138552615 16:57755771-57755793 GGCCCTGTGAGGGTGAGGGTGGG - Intronic
1138684855 16:58716061-58716083 GGCCCCATTGAGGGGAGGGTTGG + Exonic
1139952670 16:70679738-70679760 GTCCCTGCGGAGTGGGGGGTGGG + Intronic
1139994871 16:70971139-70971161 GTCCATGGGCAGGGGAGGGCAGG + Intronic
1140475607 16:75238062-75238084 GCACCTGGGGAGGGGAGGGCTGG - Intronic
1141137405 16:81475075-81475097 GGCCCTCTGGAGAGGAGGGTGGG + Intronic
1141271434 16:82544532-82544554 GTCCCTGTGTAAGAGATGGTGGG - Intergenic
1141432470 16:83977558-83977580 GGCTCTGTGGAGGGATGGGTGGG - Intronic
1141553589 16:84822110-84822132 GTCCCTGTTGGGGTGAGGCTGGG + Intronic
1141564421 16:84891758-84891780 GCCCCTGGGGAGGGCAGGGATGG + Intronic
1141665453 16:85463143-85463165 CGCCCCGTGGACGGGAGGGTGGG + Intergenic
1141895708 16:86957517-86957539 GTCCCTCCGGAGGGGAGGGAAGG - Intergenic
1141984812 16:87572827-87572849 CTTCCTGGGGAGGGGAGTGTGGG - Intergenic
1142052036 16:87965219-87965241 GGCCCTGTGGTGGGGAGAATGGG + Intronic
1142234722 16:88916626-88916648 GCCCCTGGGGAGAGGTGGGTGGG + Intronic
1142352486 16:89586551-89586573 GGCCCCGTGGTGGGGAGGGGAGG - Intronic
1142482985 17:229915-229937 GTCCCTGAGGGAGGGAGGGAGGG - Intronic
1142699364 17:1649834-1649856 GTCCCAGTGGAGGGTGGGGTGGG - Exonic
1143319182 17:6056856-6056878 GTCCCAGATGAGGGCAGGGTGGG + Intronic
1143479169 17:7218795-7218817 CTCCTTGTGGAGGGGAGGTCTGG - Intronic
1143521121 17:7444993-7445015 GTCCCGGGGGCGGGGCGGGTGGG + Intergenic
1143684704 17:8504497-8504519 ATACCTGTGCAGGGGTGGGTGGG - Intronic
1144639767 17:16930957-16930979 GTCTCTGTGGCGGGCAGGATGGG - Intronic
1144712918 17:17414209-17414231 GTCACTGTGGGGATGAGGGTGGG - Intergenic
1145267712 17:21388431-21388453 GTCCCTCTGGAGGTGGGTGTAGG + Intronic
1146398831 17:32488011-32488033 GTCCCTGCGGAGGTGACGGCAGG - Exonic
1147608324 17:41786492-41786514 GTCCCTGGGCAGGTGAGGGCCGG - Intronic
1148051910 17:44773687-44773709 GTCCCTGAGGAAGGGATGCTGGG - Intronic
1148145618 17:45362769-45362791 GTCCTTGCAGAGGGGAGGGAAGG + Intergenic
1148239151 17:45988509-45988531 GTCCCTATGGAGGCGGGGCTGGG - Intronic
1148605697 17:48927427-48927449 GGCCCTGTGGAGAGGTGTGTTGG - Exonic
1148860958 17:50604136-50604158 CACCCTGGGGAGGGGAGGGAGGG - Exonic
1149354793 17:55828648-55828670 GTCTTTGTGCGGGGGAGGGTGGG + Intronic
1150294937 17:64002483-64002505 GCCCCTGTGAAGGAGAGGGTGGG + Exonic
1151344462 17:73493122-73493144 GTCCTTGGGGAGGGGAGGGTGGG - Intronic
1152007780 17:77693391-77693413 GTCCCTGTGCCAGGGGGGGTGGG - Intergenic
1152097587 17:78280939-78280961 GTACCTGTGTTGGGGAGGCTGGG + Intergenic
1152283569 17:79399458-79399480 TTCCATGTGGAGGGCAGGGATGG + Intronic
1152312400 17:79559140-79559162 CTCCCTGAGGATGGGAGGGGCGG + Intergenic
1152776733 17:82206536-82206558 GTTCCTGGGGAGTGGTGGGTGGG + Intronic
1153267313 18:3284062-3284084 TGCCCTGTGGAGGGGAGGGGCGG + Intergenic
1153503197 18:5769445-5769467 GTGCCTGTGCAGGAGAGGATGGG - Intergenic
1160059800 18:75518656-75518678 GTCCCTGTGATGGGGTGGGGGGG + Intergenic
1160171901 18:76562312-76562334 GTCCCTGCTGAGGGGATGGGCGG - Intergenic
1160182889 18:76651008-76651030 GTCCCTGGTTAGGGGAGGGGAGG + Intergenic
1160693071 19:469013-469035 GTGCCTGTGGCGGGGAGGTCTGG - Intronic
1160695679 19:483263-483285 ATCCCTGAGGAGGTGGGGGTGGG - Intergenic
1160793075 19:931919-931941 CTCCCTGTGGAGGGAAGGGGAGG + Intronic
1160817759 19:1043897-1043919 GGCCCGGTGGATGGGAAGGTGGG + Intronic
1160957339 19:1699690-1699712 GCCGCTGGGGAGGGGAGGGTGGG + Intergenic
1160981022 19:1816641-1816663 GTCCCTGGGGAGAGGCGGCTGGG + Intronic
1161139431 19:2638736-2638758 TCCCCTGGGGAGGGGAGGGGAGG + Intronic
1161171371 19:2813967-2813989 TCCCCTGTGGATGAGAGGGTGGG - Exonic
1161206158 19:3042266-3042288 GACCCTGTGGAGGGGCAGGGAGG + Intronic
1161221522 19:3120248-3120270 GTCCCTGGGCAGGGGAGTGGCGG + Intronic
1161504208 19:4635483-4635505 GCCCCTGTGGGTGGGTGGGTGGG - Intergenic
1161560209 19:4968983-4969005 GGCCCGGCGGAGGGGAGGGGCGG + Intergenic
1162109693 19:8393427-8393449 GTCCTTGGGCAGGGGAGGGGTGG - Intronic
1162112048 19:8404635-8404657 GCCCCTGTGGCAGGGAGGGATGG + Intronic
1162345432 19:10115582-10115604 AGCCCTGTGGAGGGGCGGGATGG + Exonic
1162432148 19:10635522-10635544 GTCCCCGGGGTGGGGAGGGCAGG + Intronic
1162531412 19:11238301-11238323 GTTCCTGTGGGGGGCAGGATGGG + Exonic
1162562530 19:11425941-11425963 GTCGCTTAGGAGGGGAGGGGAGG + Intronic
1163104378 19:15115112-15115134 CTCCCTGAGGAGGGGATGGAGGG - Exonic
1163668304 19:18613239-18613261 GTCCGTGGGGAGGTGGGGGTCGG + Intronic
1163783197 19:19261241-19261263 GTCTCTGGGGAGGGGAACGTGGG + Intronic
1164567121 19:29334163-29334185 GACCCTGTGTTGGAGAGGGTGGG + Intergenic
1164721978 19:30439129-30439151 GTCTGTGTTGAGGGAAGGGTGGG - Intronic
1165167949 19:33870531-33870553 GTGGCAGTGGAGTGGAGGGTGGG + Intergenic
1165745432 19:38227871-38227893 GTCTCTGTGGGGGTGAAGGTGGG - Intronic
1166759924 19:45218028-45218050 CTCCCTGTGGATGGGAGAGGTGG - Intronic
1167172123 19:47840118-47840140 CTCCCTGTGGAGGAAAGGGGTGG - Exonic
1167299702 19:48671631-48671653 GGCCCTGGGGAGGGGAGGGAAGG + Intronic
1167561225 19:50227100-50227122 CTGCATGGGGAGGGGAGGGTGGG + Intronic
1168098386 19:54128286-54128308 GTACCTGGGGACGGGTGGGTGGG - Exonic
1168153358 19:54460607-54460629 GCCCCTGAGGTGGGGAGGCTGGG + Intronic
1168315937 19:55484814-55484836 GTCCCTGGGGATGGGGGAGTCGG + Intergenic
1168332985 19:55580492-55580514 GTCCCGGTGGAGGAGGGGCTGGG + Intronic
925338510 2:3116030-3116052 GTCCATGTGGAGCTGATGGTAGG - Intergenic
926339237 2:11891091-11891113 GTCCCTGAGAAGAGGTGGGTGGG + Intergenic
926393347 2:12416778-12416800 GTCCCTGTGAAGTGGAGACTGGG + Intergenic
927430779 2:23024745-23024767 GTCGCTGTGGAAGGAGGGGTGGG - Intergenic
928452546 2:31389332-31389354 GTCCAGGTGGTGGGGTGGGTGGG - Intronic
928971967 2:37038897-37038919 CTCCCTGGGGTGGGGGGGGTGGG + Intronic
929459541 2:42092340-42092362 CTCCCTGTGGAGGAAAGGGTAGG + Intergenic
929592733 2:43157730-43157752 GTCCCTGTGGGGCTGTGGGTGGG - Intergenic
932447137 2:71787892-71787914 GCCTCTGTGGAGGGGAGGGGTGG - Intergenic
934501979 2:94869241-94869263 GTCCCTGTGACAGGGAGGATTGG - Intergenic
934650679 2:96089716-96089738 GTCCCTGTGCAGCGTGGGGTGGG - Intergenic
934953831 2:98599936-98599958 GTCCCTGTGGAAGAGGGGATGGG - Exonic
935785025 2:106541069-106541091 GGCCCTGTGGTGGGCAGGCTTGG + Intergenic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936103613 2:109604711-109604733 GACTCTGGGGAGGGGAGGGGAGG + Intronic
936831410 2:116652896-116652918 GTCCTTTTGGTGGGGTGGGTGGG - Intergenic
937089626 2:119197198-119197220 GTGCCTGTGGGGGTGGGGGTTGG - Intergenic
937226744 2:120374721-120374743 CTCCCTGGGAAGGGGAGGGGAGG + Intergenic
937302056 2:120848584-120848606 GACCCTGGGGAGGGAAGAGTTGG + Intronic
937584339 2:123527558-123527580 GTTTTTGTGGAGGGGCGGGTGGG - Intergenic
938287245 2:130128555-130128577 CTGCCTGTGGAGGGGGTGGTTGG - Intronic
938469255 2:131544318-131544340 CTGCCTGTGGAGGGGGTGGTTGG + Intergenic
938494120 2:131783348-131783370 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
938629409 2:133149934-133149956 ATCCATCTGGAGGTGAGGGTGGG - Intronic
938639887 2:133266946-133266968 GGCCCGGCGGAGGGGAGGGGAGG - Intronic
939723163 2:145680388-145680410 GTCCCAGTGGAGAAGAGGGATGG - Intergenic
940122432 2:150281734-150281756 GTCTCTGTGGATGTGGGGGTGGG - Intergenic
941200161 2:162498484-162498506 GTGTGTGTGGGGGGGAGGGTGGG + Intronic
941380834 2:164790236-164790258 GTCCCAGTGTACGTGAGGGTGGG + Intronic
941751271 2:169137291-169137313 TTCCCTTTGGAGGGAAGGTTAGG + Intronic
944174620 2:196816231-196816253 GACCCAGAGGAGGTGAGGGTAGG + Intergenic
946049502 2:216850175-216850197 CTCCCCGGAGAGGGGAGGGTGGG - Intergenic
946063043 2:216961173-216961195 GTCCTTGTAGAGGGAGGGGTAGG + Intergenic
946166923 2:217869972-217869994 GTCACTGCGGTGGGGTGGGTGGG - Intronic
946198554 2:218055769-218055791 GGCACTGTGGCGGGGATGGTTGG - Intronic
946385393 2:219381324-219381346 GTCCCCCTGCAGGTGAGGGTGGG - Exonic
946676498 2:222165616-222165638 GTCCTTGTGGAGGGGGGGTGGGG - Intergenic
947792813 2:232877435-232877457 GGGCCTTTGGAGGGAAGGGTTGG + Intronic
947938221 2:234025670-234025692 GACGCGGTGGAGGGGGGGGTGGG - Intergenic
948294026 2:236847721-236847743 TACCCTGAGGAGGGGAGGGGCGG + Intergenic
949027186 2:241771844-241771866 GTCCTGGGGGAGGGGAGGGGCGG - Intergenic
1169006774 20:2213887-2213909 GTGGGTGTGGAGGGGTGGGTAGG - Intergenic
1169276049 20:4234451-4234473 GTCCCAGTGGAGGACAGGGTAGG - Intronic
1170075066 20:12410292-12410314 GAACCTGAGGAGGGGAGGGTGGG + Intergenic
1170652921 20:18258907-18258929 GATCCTGGGGAGGGGAGGGTTGG + Intergenic
1170674378 20:18466057-18466079 GTCTTTTTGGAGGTGAGGGTGGG + Intronic
1170863102 20:20127608-20127630 GTTCCGGTGGAGGTGACGGTTGG + Intronic
1171154431 20:22859303-22859325 GTGCCTGTGGAGGGAGTGGTGGG + Intergenic
1171349961 20:24494626-24494648 GTGCATGTGGCCGGGAGGGTGGG + Intronic
1171385929 20:24769591-24769613 GTAGCTGTGCAGGGGAGGGCAGG - Intergenic
1171442659 20:25177840-25177862 GTGGCTGTGTAGGGGAGTGTAGG + Intergenic
1172010122 20:31841780-31841802 GTAGCTCTGGAGGGGAGGGATGG - Intergenic
1172359528 20:34302734-34302756 GTCCCAGGGGAGAGGAGGATCGG + Intronic
1172479687 20:35263772-35263794 TTCCCTGTGGAGAGGAGTGTGGG - Exonic
1172711103 20:36924241-36924263 GATCCTGTTGAGGGGAGGGGAGG + Intronic
1172965348 20:38830203-38830225 GTCCCTGTGCAGTGGATGGATGG - Intronic
1173428476 20:42963725-42963747 TCCCCTGTGCAGGGTAGGGTGGG - Intronic
1173530827 20:43768135-43768157 GTCCCTGAGGAGGAGAGAGAGGG + Intergenic
1173694415 20:44996340-44996362 GCCCCTGAGGAAGGCAGGGTTGG - Intronic
1175154048 20:56957638-56957660 GCCCCCGTGCAGGGGAGAGTAGG + Intergenic
1175504093 20:59469777-59469799 GTCGCTGTGGAGGACAGGGCCGG + Intergenic
1175807359 20:61837321-61837343 GACCCTGTGGATGGCAGGGAGGG + Intronic
1176007673 20:62875271-62875293 GTGCGGGTGGGGGGGAGGGTGGG - Intergenic
1176084233 20:63288772-63288794 GTCCTCGGGGAGGTGAGGGTTGG - Exonic
1176254871 20:64146649-64146671 GGGTCTGAGGAGGGGAGGGTGGG + Intergenic
1176311428 21:5152665-5152687 GTCCCTGTGCTGTGAAGGGTGGG - Intronic
1176711397 21:10152859-10152881 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1177422816 21:20883464-20883486 TTCTCTTTGGAGGGGAGGATCGG + Intergenic
1179064790 21:38014958-38014980 GTCTCTGGGGAGGGCAGAGTGGG + Intronic
1179150635 21:38805836-38805858 GGCCGAGTGGAGGGGAGGGGAGG - Intronic
1179437768 21:41374028-41374050 GTCTCTGTGGAGGGGACACTAGG - Intronic
1179845622 21:44109370-44109392 GTCCCTGTGCTGTGAAGGGTGGG + Intronic
1179908438 21:44435911-44435933 GTCCCTGTGGATGGGTGGGGAGG - Intronic
1179993872 21:44964608-44964630 TGCCCTGTGGGCGGGAGGGTGGG + Intronic
1180040794 21:45278502-45278524 GTGCCTGAGGAGGGGAGGGTGGG + Intronic
1180082797 21:45494326-45494348 GCCACTGGTGAGGGGAGGGTCGG - Intronic
1180498313 22:15909415-15909437 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1180621863 22:17167702-17167724 GTCCCTGTGGAGGGTCAGGCTGG + Intergenic
1180708191 22:17822469-17822491 GTGCCTGTGGAGGGCAGGCCTGG + Intronic
1180958684 22:19752404-19752426 GTCTCAGTGGAGGGGAGGACTGG - Intergenic
1181001782 22:19991168-19991190 GGCCCTGTGAAATGGAGGGTGGG - Intronic
1181155772 22:20918970-20918992 GTGCCTTTGGCGGGGAGGGGTGG - Intronic
1181490921 22:23260402-23260424 GTCCCTGTGGCTGGGAGGGAGGG + Intronic
1181809584 22:25395299-25395321 GTCTGAGTGGAGGGGAGGGTGGG + Intronic
1181830821 22:25558928-25558950 CTCCCTGGGGAGGGTAGGGGTGG + Intergenic
1182095990 22:27626227-27626249 GTCCCTGTGCAGCCAAGGGTGGG - Intergenic
1182281335 22:29219313-29219335 GCCCATGGGGAGGGGAGGGGAGG - Intronic
1182547110 22:31082780-31082802 GGCCCTGTGGATGGGTGGGTGGG + Intronic
1182830606 22:33302029-33302051 GTCCCAGAGGGGTGGAGGGTGGG + Intronic
1183177175 22:36232813-36232835 GTCCAGGAGGAGGGGAGGGGTGG - Intronic
1183427527 22:37747436-37747458 GACCCTGCGGAGGAGTGGGTGGG + Intronic
1183614806 22:38937377-38937399 GGCCCTATGGAGGGAAGGGAAGG + Intergenic
1183760863 22:39815985-39816007 GTTCCTCTGGAGGTGAGGATAGG + Intronic
1184105021 22:42362438-42362460 GGCACTGTGGAGGGGAAGCTGGG + Intergenic
1184253510 22:43274406-43274428 GTCCCTGTGGAGGGCAGGGCAGG - Intronic
1184281152 22:43438260-43438282 CTCCCTGAGGAGGGGATGTTGGG + Intronic
1184343747 22:43900616-43900638 TTCCCTGTGCAGGGGAGTGTGGG - Intergenic
1184730132 22:46367249-46367271 GTCCCTGAGGAGGGGAGGCCTGG - Intronic
1185172003 22:49299632-49299654 GTGTCTGGGGAGGGGAGGGCAGG - Intergenic
950397977 3:12748828-12748850 GTCCCTGGGGTGGGAAGGGTGGG - Intronic
950673406 3:14540365-14540387 CTCCCTGGGGAGGGGAGGGAGGG - Exonic
950714871 3:14840745-14840767 GTCACTGTGGTGGGGTTGGTTGG - Intronic
950716278 3:14849919-14849941 GTCTGTGTGGAAGGGAGGGGTGG + Intronic
951035232 3:17925541-17925563 CTCCCTGTTGTGGGGAGGGGGGG - Intronic
951710395 3:25580768-25580790 GGCACCGTGGAGGGGAGGGAGGG + Intronic
953410665 3:42688850-42688872 CTTCCTGTGGGGTGGAGGGTGGG - Exonic
953574151 3:44099385-44099407 GTGTGTGTGGAGGGGAGGGATGG + Intergenic
953725466 3:45394111-45394133 GCCCATGGGGAGGGGAGGGAGGG + Intronic
953824643 3:46240373-46240395 GTCCCTGTGCAGGGGTAGGCAGG - Intronic
954106111 3:48410617-48410639 GTCCCTGTGGAGGAGGAGATGGG - Intronic
954842483 3:53524116-53524138 GTCCATGGTGAGGGGAGGATGGG + Intronic
956984207 3:74678521-74678543 GTCACTGTGGTGGGGAGAGAAGG + Intergenic
957621764 3:82603672-82603694 GTCCTTGTGCAGGGGACAGTTGG - Intergenic
959261112 3:104081660-104081682 GTCACTGTGGTGGGGGGGGTGGG + Intergenic
960995025 3:123335093-123335115 GTCCCTGGGGTGGCGAGGGCAGG - Intronic
961033933 3:123629329-123629351 TTCCCTGAGGAAGGGAGGGTGGG - Intronic
962906868 3:139811742-139811764 GTACCTGGGGAGGAGGGGGTTGG - Intergenic
963847344 3:150172571-150172593 GCCCCTGTGGAGAGGAGAGGAGG - Intergenic
964255117 3:154766813-154766835 GTAGCTGTGCTGGGGAGGGTGGG + Intergenic
964376386 3:156052246-156052268 GAGCCCATGGAGGGGAGGGTGGG - Intronic
966920070 3:184605264-184605286 GTTGGGGTGGAGGGGAGGGTGGG + Intronic
967273069 3:187746594-187746616 GTGTGTGTGGGGGGGAGGGTGGG + Intergenic
967829790 3:193909235-193909257 GTCCATGTGGAGGAGAAGGACGG + Intergenic
968453090 4:684221-684243 TGCCCTGTGGATGGGAAGGTGGG - Intronic
968522405 4:1039914-1039936 GGGCCTTGGGAGGGGAGGGTTGG + Intergenic
968523059 4:1043016-1043038 GTCAGTGTGCAGGGGTGGGTGGG - Intergenic
968600971 4:1509175-1509197 CTCCCTGAGGAAGGGAGGGAGGG - Intergenic
968876210 4:3269203-3269225 GGCCCTGAGGAGGGGAGGGCAGG + Intronic
969307896 4:6336195-6336217 GGGCGTGTGGAGGGGTGGGTTGG - Intronic
969530366 4:7727012-7727034 GGCCCTGGGGTGGGGAGGGAGGG + Intronic
970173281 4:13310256-13310278 GTCTCTGTGCAGGGGAGGTAGGG + Intergenic
970466259 4:16326064-16326086 GTCTCTGTGGAGGAGAGGAAAGG - Intergenic
970927914 4:21474525-21474547 GCCACTGTGGAAGGGAGAGTAGG - Intronic
972151684 4:36099045-36099067 GTCCATGGGGAGGGGAGGGTAGG - Intronic
974350895 4:60744689-60744711 GTTACTGTGGAGGGGAGATTAGG - Intergenic
975575712 4:75860508-75860530 TTCAGTGTGGAGGGGTGGGTTGG - Exonic
980990248 4:139733437-139733459 TTCCCAGTGGAGAGGAGGCTGGG - Intronic
981742046 4:148012891-148012913 GTTCCTTTGTAGGGGATGGTGGG + Intronic
982872931 4:160607129-160607151 GTCCCTGTAGTGGGGTGGGGGGG + Intergenic
983517558 4:168673731-168673753 TTCCATGTGGAGGCGAGGGGAGG + Intronic
984828102 4:183946399-183946421 GTCCATGAGGAGGGGGGGTTGGG + Intronic
984867329 4:184292997-184293019 GTGTGTGTGGAGGGGAGGGGAGG + Intergenic
984966541 4:185144744-185144766 GACCTGGTGGAGGGGAGGGTGGG - Exonic
985426833 4:189839616-189839638 GTCTCTGTGGAGAGGGGGTTTGG - Intergenic
985610673 5:886280-886302 GGCGCTGTGCAGGGGAGGGAGGG + Intronic
985708656 5:1415787-1415809 GTCCTTGTGGAGGGAGGGGCTGG + Intronic
986488917 5:8269478-8269500 GCTCCTGTGGAGGTGAGGGGTGG + Intergenic
986931454 5:12827710-12827732 GTTCCTGTGGAGAGGATGATCGG - Intergenic
988506294 5:31826274-31826296 GCCACCGTGGTGGGGAGGGTAGG + Intronic
988526075 5:31988422-31988444 GTCCTTGTGGAGATGGGGGTGGG + Intronic
990589931 5:57252132-57252154 GTGCCTGTGGGGGTGGGGGTGGG - Intronic
991965471 5:72086199-72086221 GTCACTGGGGAAGGGTGGGTTGG + Intergenic
991973183 5:72160749-72160771 GTCCCTGAGGTGGAGAGGGTGGG - Intronic
992082228 5:73245519-73245541 TTACCTCTGGAGGAGAGGGTAGG + Intergenic
995482187 5:112604374-112604396 TTCCCTCTGGTGGGGAGGCTTGG - Intergenic
995770475 5:115664322-115664344 GTACTTGTGGGGGTGAGGGTGGG - Intergenic
996621934 5:125515733-125515755 GTCCCTTTGGAGGTGTAGGTGGG + Intergenic
997444786 5:133933234-133933256 CTCCCAGTGGTGGGGAGGCTTGG + Intergenic
997858847 5:137397862-137397884 GCCTCTGTGGACAGGAGGGTGGG - Intronic
998842967 5:146275755-146275777 ATCCCTGTTGAAGGGAGGTTCGG + Intronic
999256665 5:150213390-150213412 GTCTCTGTGGCGGGGAAGGAGGG + Intronic
999765946 5:154740971-154740993 GCCCCTGAGGAGAGGATGGTGGG - Intronic
1000796527 5:165671395-165671417 GTCACTGTGGAGTAGATGGTTGG + Intergenic
1001635556 5:173207600-173207622 GCCCTGGTGGAGGGGAGGGATGG + Intergenic
1003336363 6:5176540-5176562 GTTCCTGAGGAGGGGAGGAACGG - Intronic
1004542158 6:16561381-16561403 GTATCTGTGGAGAGGTGGGTGGG - Intronic
1006162895 6:32048362-32048384 GTCCCTGTGGAGGCCAGGACCGG - Intronic
1006851551 6:37102457-37102479 GCCACCGTGGAGGGGAGGGAGGG - Intergenic
1006882777 6:37354289-37354311 GGTCCTGTGGAGCGGAGGGCAGG + Intronic
1006936641 6:37723348-37723370 CTCTCTGGGGAGGGGAGGGCTGG + Intergenic
1007664513 6:43506394-43506416 CTCCCTCTGGAAAGGAGGGTGGG + Exonic
1008642140 6:53474926-53474948 GTCCCTGTGGAGAGGACAATTGG + Intergenic
1008935888 6:56991830-56991852 GTACCTGTGGAGGGGAGTGTGGG - Intronic
1012696473 6:102390930-102390952 GTCCCTGTGGGGGATAGAGTTGG - Intergenic
1015547739 6:134378666-134378688 GTCATTGTGGGGTGGAGGGTGGG - Intergenic
1016529841 6:145045324-145045346 TTCACTGTAGAGGTGAGGGTTGG + Intergenic
1016953976 6:149608700-149608722 GTGACTGTGGCGGGGAGGGGTGG - Intronic
1017318597 6:153062097-153062119 GTCCTTGTGAAGGGTGGGGTGGG - Intronic
1017436200 6:154417990-154418012 GACTCTGTGGAGCTGAGGGTGGG - Intronic
1019265647 7:116181-116203 GCCCCTGTGGAGGGCAAGGAGGG - Intergenic
1019473052 7:1231426-1231448 GTGCCTGGGCCGGGGAGGGTGGG - Intergenic
1019558973 7:1646584-1646606 TCCCCTGGGGAGGGGAGGCTGGG - Intergenic
1019620261 7:1988354-1988376 GTCCCTGTGGTGGGGATGGCTGG - Intronic
1019630507 7:2046414-2046436 GCCTGTCTGGAGGGGAGGGTTGG - Intronic
1019863876 7:3686819-3686841 ATCCCTGTGGATTGGAGAGTTGG + Intronic
1019953747 7:4395211-4395233 GTCCCTGTGGGGTGGACAGTTGG + Intergenic
1020186048 7:5960546-5960568 GGCCATGTGGAGGGCAGGGGAGG - Intronic
1020296869 7:6764224-6764246 GGCCATGTGGAGGGCAGGGGAGG + Intronic
1021268831 7:18559504-18559526 ATCCCTGAGGAGGAGGGGGTAGG + Intronic
1022099839 7:27162358-27162380 GTCTCTGGGTAGGGGCGGGTTGG - Intergenic
1022503660 7:30897498-30897520 GTCCTTGTGCTGGGGAGGGGAGG - Intergenic
1023035672 7:36129375-36129397 GAGCATGTGCAGGGGAGGGTGGG + Intergenic
1023246479 7:38210425-38210447 GTCCCTGTGGCAAGGAGGGAAGG - Intronic
1023875758 7:44285436-44285458 GTTCCTGTAGGGGGGAGGCTGGG - Intronic
1024043028 7:45569443-45569465 GCCCCTATGAAGGGGAGAGTTGG + Intergenic
1024865501 7:53901000-53901022 GTCCCTGTGTGGGTGAGTGTGGG + Intergenic
1025979987 7:66397488-66397510 GTCCCTGCAGATGGGTGGGTAGG - Intronic
1026255827 7:68710271-68710293 GGGCCTGTTGAGGGTAGGGTTGG + Intergenic
1026901983 7:74042595-74042617 AGCCCTGCGGAGGGGAGGATGGG - Exonic
1029283818 7:99452921-99452943 GCTCCTGTGGAGTGGAGGTTGGG + Intronic
1029408193 7:100390383-100390405 GTTCCTGGGGAGGAGAGGGGAGG + Intronic
1032017523 7:128389386-128389408 GTCAGTGTGGAGGGGAGGCAGGG - Intergenic
1032119955 7:129148527-129148549 GTCCATGAGGAAGGGAGGATGGG - Intronic
1032210652 7:129911036-129911058 GTCGCAATGGAGGGCAGGGTTGG + Intronic
1033550718 7:142445230-142445252 AACCCTGGGGAGGGGAGGGCAGG + Intergenic
1033620553 7:143058479-143058501 GTGTCTGTGGAGGAGAGGGAAGG - Intergenic
1033707403 7:143902586-143902608 CTCCCCCTGGAGGGGAGGGGAGG - Intergenic
1035932475 8:3797433-3797455 TTGCCTGTGGAGGGAAGGGATGG - Intronic
1036948857 8:13121873-13121895 ATACCTGGGGAGGGGATGGTCGG - Intronic
1038446604 8:27608879-27608901 ATCCCACTGGAGGGGAGGGAGGG - Intronic
1038457495 8:27686946-27686968 GGGCCTGTCGAGGGGTGGGTGGG - Intergenic
1039473797 8:37828985-37829007 CTCCCTCGGGAGGGGAGGGGTGG - Intronic
1039532167 8:38272526-38272548 GGCACTGTGCAGGGGAGGGAGGG - Exonic
1039842862 8:41306509-41306531 GTCCCTGTGGAGGGGAGGGTGGG - Intronic
1040875000 8:52141815-52141837 GCCCCTGTGGGGTGGTGGGTGGG + Intronic
1042670991 8:71263184-71263206 GACCCAGTGCAGGGGAGGCTGGG - Intronic
1042875568 8:73437723-73437745 ATGCCTGGGGAGGGGAGGCTGGG + Intronic
1045870760 8:106924345-106924367 GTGTGTGTGGAGGGGAGGGCAGG + Intergenic
1047097340 8:121639739-121639761 GTCCCTGTGAACAGGAGGGCGGG - Intronic
1048829506 8:138462551-138462573 GTCACTGGGGAGAGGAGGGCAGG + Intronic
1048848885 8:138625360-138625382 GGCACAGTGGAGGGCAGGGTTGG + Intronic
1049170176 8:141155106-141155128 GGGCTTGTGGAGGGGAGGCTGGG + Intronic
1049335028 8:142079759-142079781 GTCCCTGCAGAGAGGAGGGGAGG - Intergenic
1049558157 8:143293932-143293954 GCTCCTGTGGAGGTGGGGGTGGG - Intronic
1049735465 8:144202610-144202632 CTCTCTGTGGAGGGGTGGGGAGG + Intronic
1049735525 8:144202807-144202829 CTCTCTGTGGAGGGGCGGGGGGG + Intronic
1049735539 8:144202838-144202860 CTCTCTGTGGAGGGGCGGGGGGG + Intronic
1049735733 8:144203342-144203364 CTCTCTGTGGAGGGGCGGGGAGG + Intronic
1049785405 8:144448393-144448415 GTCTCTGGGGTGGGGAAGGTGGG - Intergenic
1050081431 9:1919819-1919841 GTCCCTGAGAAGGGGTGGGCAGG + Intergenic
1050925851 9:11261854-11261876 GGGCCTGTTGTGGGGAGGGTGGG + Intergenic
1051580720 9:18670866-18670888 GTATCTGTGGAGGTGGGGGTGGG - Intronic
1052137796 9:24937042-24937064 TTCCCTGAAAAGGGGAGGGTTGG - Intergenic
1052803234 9:32989477-32989499 GTCCCTGGGGAAAGGAGGGCAGG + Intronic
1053648385 9:40138550-40138572 GACCCTGTGGACGGGGAGGTGGG - Intergenic
1053787431 9:41662812-41662834 GGCCCTGTGGAGGGGCTGGGAGG - Intergenic
1054157695 9:61651955-61651977 GGCCCTGTGGAGGGGCTGGGAGG + Intergenic
1054175707 9:61874151-61874173 GGCCCTGTGGAGGGGCTGGGAGG - Intergenic
1054329363 9:63736493-63736515 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1054477469 9:65582960-65582982 GGCCCTGTGGAGGGGCTGGGAGG + Intergenic
1054661832 9:67706659-67706681 GGCCCTGTGGAGGGGCTGGGAGG + Intergenic
1056262509 9:84862900-84862922 GGCCCTGGGGTGGGGAGGGCAGG + Intronic
1056506524 9:87263380-87263402 TTGCCTGTGGAGAGGAGGCTGGG - Intergenic
1056756082 9:89382878-89382900 GTAGCTGTGGAGGGTGGGGTGGG + Intronic
1056850117 9:90076624-90076646 GTTCCAGAGGAGGGGAGGGATGG - Intergenic
1057037279 9:91820568-91820590 GTGGGTGTGGAGGGGAGGGGAGG - Intronic
1057139565 9:92718372-92718394 GGCCCTGAGCAGGGGAGGGTAGG + Intronic
1058667465 9:107333593-107333615 TTCACTGTGGAGAGGAGGCTGGG + Intergenic
1060105115 9:120868767-120868789 CACCCTGTGGAGGGGCGGGGTGG - Intronic
1060543676 9:124448296-124448318 GGCTCTGTGGAGGGGAGATTAGG + Intergenic
1060996156 9:127875809-127875831 GAGCCTGGGGAGGGGAGGGTTGG - Intronic
1061120938 9:128641825-128641847 TGGCCTGTGGAGGTGAGGGTGGG - Intronic
1061182711 9:129034433-129034455 CTCCGTGGGGAGGGGAGGGAAGG - Intergenic
1061371644 9:130200850-130200872 GGCCGTGGGGAGGGGAGGGCTGG + Intronic
1061772357 9:132935698-132935720 GTCAAGGTGGTGGGGAGGGTTGG - Intronic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1061955970 9:133961524-133961546 GTTCCTGTTGAGCGGGGGGTGGG - Intronic
1062005430 9:134236404-134236426 GTCCCAGTGGAGGGCAGGTTGGG + Intergenic
1062024037 9:134332301-134332323 GTCCCAGGGCAGGGCAGGGTAGG + Intronic
1062033378 9:134372026-134372048 CTCCCTGGGGAGGGGAGGAGAGG + Intronic
1062288760 9:135785414-135785436 GGCCCTGTGGGTGGGTGGGTGGG - Intronic
1062688169 9:137827111-137827133 GTCCCTGAGGAGGTGAGGGCAGG - Intronic
1202796150 9_KI270719v1_random:121848-121870 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1203784220 EBV:118309-118331 GTCCCTTTGGAGGACAGCGTGGG + Intergenic
1186102628 X:6173151-6173173 CTCCCTGTGGAGAGGAGGGAAGG + Intronic
1187235155 X:17460047-17460069 ATCCCTGTTGGGGGGAGGTTGGG + Intronic
1188525572 X:31084332-31084354 GGCCTACTGGAGGGGAGGGTGGG + Intergenic
1189281774 X:39824190-39824212 GTCTCTGTGAAGTGGAGTGTGGG - Intergenic
1190417792 X:50198429-50198451 GGACCTGGGGAGGGGAGGCTGGG - Intronic
1190708859 X:53051010-53051032 CTCCCTGTTGAGGGGAGACTTGG + Intronic
1192203926 X:69083648-69083670 GTGCCTGTGGAAGGGTGGGAGGG - Intergenic
1193293533 X:79806385-79806407 GTCCTTGTGGGGGTGGGGGTTGG + Intergenic
1193637805 X:83974287-83974309 GTCCTTGTGGAGGGGATGATCGG - Intergenic
1194001257 X:88432360-88432382 GTGGCTGTGGGGGTGAGGGTAGG - Intergenic
1194595016 X:95847260-95847282 TTCCTTCTGGAGGGGAAGGTGGG - Intergenic
1195216862 X:102712024-102712046 GTCCCTGTGAGGGGGGCGGTTGG + Intergenic
1195704055 X:107725909-107725931 GTTCCTGTAGAAGGGAGGTTGGG - Intronic
1196794455 X:119490959-119490981 GTCCCTGGGGTGGGGAGTTTGGG - Intergenic
1197648375 X:129040969-129040991 CTCCCTCTGGAAGGGAAGGTGGG - Intergenic
1198417263 X:136433460-136433482 GTCCCTGGGGAGGTGAGGTAAGG - Intergenic
1200047406 X:153410148-153410170 GGCCATGTGGAGGCGAAGGTGGG - Intergenic
1200089279 X:153626813-153626835 GGCCATGTGGAGGCGAAGGTGGG + Intergenic
1200163808 X:154022564-154022586 TGCCCTGGGAAGGGGAGGGTGGG + Intronic
1200424649 Y:3007725-3007747 CTCCCTCTGGAGGGGAGGATGGG + Intergenic
1200818207 Y:7555293-7555315 CTCCCTGGGCAGGGGAAGGTTGG + Intergenic