ID: 1039843798

View in Genome Browser
Species Human (GRCh38)
Location 8:41311454-41311476
Sequence CGCATTTGGCTTGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039843798_1039843803 1 Left 1039843798 8:41311454-41311476 CCCTCCACCTCAAGCCAAATGCG No data
Right 1039843803 8:41311478-41311500 CTGTTTGCTCACTGCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039843798 Original CRISPR CGCATTTGGCTTGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr