ID: 1039848383

View in Genome Browser
Species Human (GRCh38)
Location 8:41342307-41342329
Sequence TTCAAAGGGTTGAGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039848383_1039848390 -4 Left 1039848383 8:41342307-41342329 CCCTCACCCCTCAACCCTTTGAA No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data
1039848383_1039848397 21 Left 1039848383 8:41342307-41342329 CCCTCACCCCTCAACCCTTTGAA No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848383_1039848392 11 Left 1039848383 8:41342307-41342329 CCCTCACCCCTCAACCCTTTGAA No data
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data
1039848383_1039848396 20 Left 1039848383 8:41342307-41342329 CCCTCACCCCTCAACCCTTTGAA No data
Right 1039848396 8:41342350-41342372 TGCCTCCTTTCAGGCCACTGTGG No data
1039848383_1039848399 22 Left 1039848383 8:41342307-41342329 CCCTCACCCCTCAACCCTTTGAA No data
Right 1039848399 8:41342352-41342374 CCTCCTTTCAGGCCACTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039848383 Original CRISPR TTCAAAGGGTTGAGGGGTGA GGG (reversed) Intergenic