ID: 1039848385

View in Genome Browser
Species Human (GRCh38)
Location 8:41342313-41342335
Sequence AGTGGCTTCAAAGGGTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039848385_1039848399 16 Left 1039848385 8:41342313-41342335 CCCCTCAACCCTTTGAAGCCACT No data
Right 1039848399 8:41342352-41342374 CCTCCTTTCAGGCCACTGTGGGG No data
1039848385_1039848397 15 Left 1039848385 8:41342313-41342335 CCCCTCAACCCTTTGAAGCCACT No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848385_1039848390 -10 Left 1039848385 8:41342313-41342335 CCCCTCAACCCTTTGAAGCCACT No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data
1039848385_1039848396 14 Left 1039848385 8:41342313-41342335 CCCCTCAACCCTTTGAAGCCACT No data
Right 1039848396 8:41342350-41342372 TGCCTCCTTTCAGGCCACTGTGG No data
1039848385_1039848392 5 Left 1039848385 8:41342313-41342335 CCCCTCAACCCTTTGAAGCCACT No data
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039848385 Original CRISPR AGTGGCTTCAAAGGGTTGAG GGG (reversed) Intergenic