ID: 1039848386

View in Genome Browser
Species Human (GRCh38)
Location 8:41342314-41342336
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039848386_1039848399 15 Left 1039848386 8:41342314-41342336 CCCTCAACCCTTTGAAGCCACTC No data
Right 1039848399 8:41342352-41342374 CCTCCTTTCAGGCCACTGTGGGG No data
1039848386_1039848392 4 Left 1039848386 8:41342314-41342336 CCCTCAACCCTTTGAAGCCACTC No data
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data
1039848386_1039848397 14 Left 1039848386 8:41342314-41342336 CCCTCAACCCTTTGAAGCCACTC No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848386_1039848396 13 Left 1039848386 8:41342314-41342336 CCCTCAACCCTTTGAAGCCACTC No data
Right 1039848396 8:41342350-41342372 TGCCTCCTTTCAGGCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039848386 Original CRISPR GAGTGGCTTCAAAGGGTTGA GGG (reversed) Intergenic
No off target data available for this crispr