ID: 1039848390

View in Genome Browser
Species Human (GRCh38)
Location 8:41342326-41342348
Sequence TGAAGCCACTCATTTGTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039848384_1039848390 -5 Left 1039848384 8:41342308-41342330 CCTCACCCCTCAACCCTTTGAAG No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data
1039848378_1039848390 22 Left 1039848378 8:41342281-41342303 CCCTCCCTCTGAGGGGTAGGGGG No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data
1039848380_1039848390 21 Left 1039848380 8:41342282-41342304 CCTCCCTCTGAGGGGTAGGGGGA No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data
1039848385_1039848390 -10 Left 1039848385 8:41342313-41342335 CCCCTCAACCCTTTGAAGCCACT No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data
1039848376_1039848390 23 Left 1039848376 8:41342280-41342302 CCCCTCCCTCTGAGGGGTAGGGG No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data
1039848381_1039848390 18 Left 1039848381 8:41342285-41342307 CCCTCTGAGGGGTAGGGGGACAC No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data
1039848383_1039848390 -4 Left 1039848383 8:41342307-41342329 CCCTCACCCCTCAACCCTTTGAA No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data
1039848382_1039848390 17 Left 1039848382 8:41342286-41342308 CCTCTGAGGGGTAGGGGGACACC No data
Right 1039848390 8:41342326-41342348 TGAAGCCACTCATTTGTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039848390 Original CRISPR TGAAGCCACTCATTTGTCCC CGG Intergenic