ID: 1039848391

View in Genome Browser
Species Human (GRCh38)
Location 8:41342331-41342353
Sequence GGCAGCCGGGGACAAATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039848391_1039848397 -3 Left 1039848391 8:41342331-41342353 CCACTCATTTGTCCCCGGCTGCC No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848391_1039848399 -2 Left 1039848391 8:41342331-41342353 CCACTCATTTGTCCCCGGCTGCC No data
Right 1039848399 8:41342352-41342374 CCTCCTTTCAGGCCACTGTGGGG No data
1039848391_1039848403 28 Left 1039848391 8:41342331-41342353 CCACTCATTTGTCCCCGGCTGCC No data
Right 1039848403 8:41342382-41342404 AAGAAGAAGAGTTTGCAAACGGG No data
1039848391_1039848402 27 Left 1039848391 8:41342331-41342353 CCACTCATTTGTCCCCGGCTGCC No data
Right 1039848402 8:41342381-41342403 TAAGAAGAAGAGTTTGCAAACGG No data
1039848391_1039848396 -4 Left 1039848391 8:41342331-41342353 CCACTCATTTGTCCCCGGCTGCC No data
Right 1039848396 8:41342350-41342372 TGCCTCCTTTCAGGCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039848391 Original CRISPR GGCAGCCGGGGACAAATGAG TGG (reversed) Intergenic