ID: 1039848392

View in Genome Browser
Species Human (GRCh38)
Location 8:41342341-41342363
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039848384_1039848392 10 Left 1039848384 8:41342308-41342330 CCTCACCCCTCAACCCTTTGAAG No data
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data
1039848387_1039848392 3 Left 1039848387 8:41342315-41342337 CCTCAACCCTTTGAAGCCACTCA No data
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data
1039848389_1039848392 -4 Left 1039848389 8:41342322-41342344 CCTTTGAAGCCACTCATTTGTCC No data
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data
1039848386_1039848392 4 Left 1039848386 8:41342314-41342336 CCCTCAACCCTTTGAAGCCACTC No data
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data
1039848385_1039848392 5 Left 1039848385 8:41342313-41342335 CCCCTCAACCCTTTGAAGCCACT No data
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data
1039848383_1039848392 11 Left 1039848383 8:41342307-41342329 CCCTCACCCCTCAACCCTTTGAA No data
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data
1039848388_1039848392 -3 Left 1039848388 8:41342321-41342343 CCCTTTGAAGCCACTCATTTGTC 0: 1
1: 1
2: 1
3: 13
4: 182
Right 1039848392 8:41342341-41342363 GTCCCCGGCTGCCTCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039848392 Original CRISPR GTCCCCGGCTGCCTCCTTTC AGG Intergenic