ID: 1039848397

View in Genome Browser
Species Human (GRCh38)
Location 8:41342351-41342373
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039848384_1039848397 20 Left 1039848384 8:41342308-41342330 CCTCACCCCTCAACCCTTTGAAG No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848388_1039848397 7 Left 1039848388 8:41342321-41342343 CCCTTTGAAGCCACTCATTTGTC No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848387_1039848397 13 Left 1039848387 8:41342315-41342337 CCTCAACCCTTTGAAGCCACTCA No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848389_1039848397 6 Left 1039848389 8:41342322-41342344 CCTTTGAAGCCACTCATTTGTCC No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848385_1039848397 15 Left 1039848385 8:41342313-41342335 CCCCTCAACCCTTTGAAGCCACT No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848386_1039848397 14 Left 1039848386 8:41342314-41342336 CCCTCAACCCTTTGAAGCCACTC No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848383_1039848397 21 Left 1039848383 8:41342307-41342329 CCCTCACCCCTCAACCCTTTGAA No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data
1039848391_1039848397 -3 Left 1039848391 8:41342331-41342353 CCACTCATTTGTCCCCGGCTGCC No data
Right 1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039848397 Original CRISPR GCCTCCTTTCAGGCCACTGT GGG Intergenic