ID: 1039848402

View in Genome Browser
Species Human (GRCh38)
Location 8:41342381-41342403
Sequence TAAGAAGAAGAGTTTGCAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039848395_1039848402 13 Left 1039848395 8:41342345-41342367 CCGGCTGCCTCCTTTCAGGCCAC No data
Right 1039848402 8:41342381-41342403 TAAGAAGAAGAGTTTGCAAACGG No data
1039848391_1039848402 27 Left 1039848391 8:41342331-41342353 CCACTCATTTGTCCCCGGCTGCC No data
Right 1039848402 8:41342381-41342403 TAAGAAGAAGAGTTTGCAAACGG No data
1039848401_1039848402 -6 Left 1039848401 8:41342364-41342386 CCACTGTGGGGAGCTGATAAGAA No data
Right 1039848402 8:41342381-41342403 TAAGAAGAAGAGTTTGCAAACGG No data
1039848393_1039848402 15 Left 1039848393 8:41342343-41342365 CCCCGGCTGCCTCCTTTCAGGCC No data
Right 1039848402 8:41342381-41342403 TAAGAAGAAGAGTTTGCAAACGG No data
1039848400_1039848402 3 Left 1039848400 8:41342355-41342377 CCTTTCAGGCCACTGTGGGGAGC No data
Right 1039848402 8:41342381-41342403 TAAGAAGAAGAGTTTGCAAACGG No data
1039848398_1039848402 6 Left 1039848398 8:41342352-41342374 CCTCCTTTCAGGCCACTGTGGGG No data
Right 1039848402 8:41342381-41342403 TAAGAAGAAGAGTTTGCAAACGG No data
1039848394_1039848402 14 Left 1039848394 8:41342344-41342366 CCCGGCTGCCTCCTTTCAGGCCA No data
Right 1039848402 8:41342381-41342403 TAAGAAGAAGAGTTTGCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039848402 Original CRISPR TAAGAAGAAGAGTTTGCAAA CGG Intergenic