ID: 1039848550

View in Genome Browser
Species Human (GRCh38)
Location 8:41343265-41343287
Sequence CATGCCCGCCGCCAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039848543_1039848550 7 Left 1039848543 8:41343235-41343257 CCCTGCTCTCATGTGGGAAGAAG No data
Right 1039848550 8:41343265-41343287 CATGCCCGCCGCCAAGGGGAAGG No data
1039848538_1039848550 25 Left 1039848538 8:41343217-41343239 CCTGCTTTCCTTTTCCTTCCCTG No data
Right 1039848550 8:41343265-41343287 CATGCCCGCCGCCAAGGGGAAGG No data
1039848539_1039848550 17 Left 1039848539 8:41343225-41343247 CCTTTTCCTTCCCTGCTCTCATG No data
Right 1039848550 8:41343265-41343287 CATGCCCGCCGCCAAGGGGAAGG No data
1039848537_1039848550 26 Left 1039848537 8:41343216-41343238 CCCTGCTTTCCTTTTCCTTCCCT No data
Right 1039848550 8:41343265-41343287 CATGCCCGCCGCCAAGGGGAAGG No data
1039848542_1039848550 11 Left 1039848542 8:41343231-41343253 CCTTCCCTGCTCTCATGTGGGAA No data
Right 1039848550 8:41343265-41343287 CATGCCCGCCGCCAAGGGGAAGG No data
1039848544_1039848550 6 Left 1039848544 8:41343236-41343258 CCTGCTCTCATGTGGGAAGAAGG No data
Right 1039848550 8:41343265-41343287 CATGCCCGCCGCCAAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039848550 Original CRISPR CATGCCCGCCGCCAAGGGGA AGG Intergenic
No off target data available for this crispr