ID: 1039850519

View in Genome Browser
Species Human (GRCh38)
Location 8:41360937-41360959
Sequence GCAGCAAGTGAGAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039850516_1039850519 12 Left 1039850516 8:41360902-41360924 CCTTGAAAACTAACAGGTATTTC No data
Right 1039850519 8:41360937-41360959 GCAGCAAGTGAGAAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039850519 Original CRISPR GCAGCAAGTGAGAAGGAAGC TGG Intergenic
No off target data available for this crispr