ID: 1039856784

View in Genome Browser
Species Human (GRCh38)
Location 8:41421962-41421984
Sequence CAGGCGCCCGCCACCTCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218988
Summary {0: 561, 1: 13132, 2: 34848, 3: 55996, 4: 114451}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039856784_1039856793 15 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856793 8:41422000-41422022 GGGAGGCTGAGGCAGGAGAATGG 0: 61556
1: 45979
2: 19513
3: 9543
4: 8794
1039856784_1039856794 28 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856794 8:41422013-41422035 AGGAGAATGGCGTGAAGCCCAGG 0: 3
1: 686
2: 979
3: 1470
4: 3562
1039856784_1039856788 -2 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856788 8:41421983-41422005 TGTAGTCCCAGCTACTCGGGAGG 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
1039856784_1039856785 -6 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856785 8:41421979-41422001 CGCCTGTAGTCCCAGCTACTCGG 0: 42478
1: 106370
2: 174364
3: 132619
4: 206690
1039856784_1039856790 4 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856790 8:41421989-41422011 CCCAGCTACTCGGGAGGCTGAGG 0: 97626
1: 275854
2: 227041
3: 130261
4: 162635
1039856784_1039856792 8 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856792 8:41421993-41422015 GCTACTCGGGAGGCTGAGGCAGG 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401
1039856784_1039856795 29 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856795 8:41422014-41422036 GGAGAATGGCGTGAAGCCCAGGG 0: 2
1: 298
2: 430
3: 987
4: 1795
1039856784_1039856786 -5 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856786 8:41421980-41422002 GCCTGTAGTCCCAGCTACTCGGG 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
1039856784_1039856796 30 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856796 8:41422015-41422037 GAGAATGGCGTGAAGCCCAGGGG 0: 2
1: 407
2: 1600
3: 38713
4: 55008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039856784 Original CRISPR CAGGCGCCCGCCACCTCGCC CGG (reversed) Intergenic
Too many off-targets to display for this crispr