ID: 1039856787

View in Genome Browser
Species Human (GRCh38)
Location 8:41421981-41422003
Sequence TCCCGAGTAGCTGGGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 802747
Summary {0: 54379, 1: 173656, 2: 264604, 3: 194654, 4: 115454}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039856787_1039856794 9 Left 1039856787 8:41421981-41422003 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1039856794 8:41422013-41422035 AGGAGAATGGCGTGAAGCCCAGG 0: 3
1: 686
2: 979
3: 1470
4: 3562
1039856787_1039856796 11 Left 1039856787 8:41421981-41422003 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1039856796 8:41422015-41422037 GAGAATGGCGTGAAGCCCAGGGG 0: 2
1: 407
2: 1600
3: 38713
4: 55008
1039856787_1039856798 15 Left 1039856787 8:41421981-41422003 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1039856798 8:41422019-41422041 ATGGCGTGAAGCCCAGGGGGCGG 0: 2
1: 287
2: 292
3: 309
4: 622
1039856787_1039856793 -4 Left 1039856787 8:41421981-41422003 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1039856793 8:41422000-41422022 GGGAGGCTGAGGCAGGAGAATGG 0: 61556
1: 45979
2: 19513
3: 9543
4: 8794
1039856787_1039856795 10 Left 1039856787 8:41421981-41422003 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1039856795 8:41422014-41422036 GGAGAATGGCGTGAAGCCCAGGG 0: 2
1: 298
2: 430
3: 987
4: 1795
1039856787_1039856797 12 Left 1039856787 8:41421981-41422003 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG 0: 2
1: 337
2: 432
3: 637
4: 1224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039856787 Original CRISPR TCCCGAGTAGCTGGGACTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr