ID: 1039856789 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:41421989-41422011 |
Sequence | CCTCAGCCTCCCGAGTAGCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 901262 | |||
Summary | {0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1039856789_1039856794 | 1 | Left | 1039856789 | 8:41421989-41422011 | CCCAGCTACTCGGGAGGCTGAGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
||
Right | 1039856794 | 8:41422013-41422035 | AGGAGAATGGCGTGAAGCCCAGG | 0: 3 1: 686 2: 979 3: 1470 4: 3562 |
||||
1039856789_1039856797 | 4 | Left | 1039856789 | 8:41421989-41422011 | CCCAGCTACTCGGGAGGCTGAGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
||
Right | 1039856797 | 8:41422016-41422038 | AGAATGGCGTGAAGCCCAGGGGG | 0: 2 1: 337 2: 432 3: 637 4: 1224 |
||||
1039856789_1039856795 | 2 | Left | 1039856789 | 8:41421989-41422011 | CCCAGCTACTCGGGAGGCTGAGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
||
Right | 1039856795 | 8:41422014-41422036 | GGAGAATGGCGTGAAGCCCAGGG | 0: 2 1: 298 2: 430 3: 987 4: 1795 |
||||
1039856789_1039856796 | 3 | Left | 1039856789 | 8:41421989-41422011 | CCCAGCTACTCGGGAGGCTGAGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
||
Right | 1039856796 | 8:41422015-41422037 | GAGAATGGCGTGAAGCCCAGGGG | 0: 2 1: 407 2: 1600 3: 38713 4: 55008 |
||||
1039856789_1039856798 | 7 | Left | 1039856789 | 8:41421989-41422011 | CCCAGCTACTCGGGAGGCTGAGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
||
Right | 1039856798 | 8:41422019-41422041 | ATGGCGTGAAGCCCAGGGGGCGG | 0: 2 1: 287 2: 292 3: 309 4: 622 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1039856789 | Original CRISPR | CCTCAGCCTCCCGAGTAGCT GGG (reversed) | Intergenic | ||
Too many off-targets to display for this crispr |