ID: 1039856789

View in Genome Browser
Species Human (GRCh38)
Location 8:41421989-41422011
Sequence CCTCAGCCTCCCGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 901262
Summary {0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039856789_1039856794 1 Left 1039856789 8:41421989-41422011 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1039856794 8:41422013-41422035 AGGAGAATGGCGTGAAGCCCAGG 0: 3
1: 686
2: 979
3: 1470
4: 3562
1039856789_1039856797 4 Left 1039856789 8:41421989-41422011 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG 0: 2
1: 337
2: 432
3: 637
4: 1224
1039856789_1039856795 2 Left 1039856789 8:41421989-41422011 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1039856795 8:41422014-41422036 GGAGAATGGCGTGAAGCCCAGGG 0: 2
1: 298
2: 430
3: 987
4: 1795
1039856789_1039856796 3 Left 1039856789 8:41421989-41422011 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1039856796 8:41422015-41422037 GAGAATGGCGTGAAGCCCAGGGG 0: 2
1: 407
2: 1600
3: 38713
4: 55008
1039856789_1039856798 7 Left 1039856789 8:41421989-41422011 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1039856798 8:41422019-41422041 ATGGCGTGAAGCCCAGGGGGCGG 0: 2
1: 287
2: 292
3: 309
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039856789 Original CRISPR CCTCAGCCTCCCGAGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr