ID: 1039856794

View in Genome Browser
Species Human (GRCh38)
Location 8:41422013-41422035
Sequence AGGAGAATGGCGTGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6700
Summary {0: 3, 1: 686, 2: 979, 3: 1470, 4: 3562}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039856791_1039856794 0 Left 1039856791 8:41421990-41422012 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1039856794 8:41422013-41422035 AGGAGAATGGCGTGAAGCCCAGG 0: 3
1: 686
2: 979
3: 1470
4: 3562
1039856789_1039856794 1 Left 1039856789 8:41421989-41422011 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1039856794 8:41422013-41422035 AGGAGAATGGCGTGAAGCCCAGG 0: 3
1: 686
2: 979
3: 1470
4: 3562
1039856787_1039856794 9 Left 1039856787 8:41421981-41422003 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1039856794 8:41422013-41422035 AGGAGAATGGCGTGAAGCCCAGG 0: 3
1: 686
2: 979
3: 1470
4: 3562
1039856784_1039856794 28 Left 1039856784 8:41421962-41421984 CCGGGCGAGGTGGCGGGCGCCTG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
Right 1039856794 8:41422013-41422035 AGGAGAATGGCGTGAAGCCCAGG 0: 3
1: 686
2: 979
3: 1470
4: 3562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039856794 Original CRISPR AGGAGAATGGCGTGAAGCCC AGG Intergenic
Too many off-targets to display for this crispr