ID: 1039856797

View in Genome Browser
Species Human (GRCh38)
Location 8:41422016-41422038
Sequence AGAATGGCGTGAAGCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2632
Summary {0: 2, 1: 337, 2: 432, 3: 637, 4: 1224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039856787_1039856797 12 Left 1039856787 8:41421981-41422003 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG 0: 2
1: 337
2: 432
3: 637
4: 1224
1039856789_1039856797 4 Left 1039856789 8:41421989-41422011 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG 0: 2
1: 337
2: 432
3: 637
4: 1224
1039856791_1039856797 3 Left 1039856791 8:41421990-41422012 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG 0: 2
1: 337
2: 432
3: 637
4: 1224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039856797 Original CRISPR AGAATGGCGTGAAGCCCAGG GGG Intergenic
Too many off-targets to display for this crispr