ID: 1039856797 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:41422016-41422038 |
| Sequence | AGAATGGCGTGAAGCCCAGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2632 | |||
| Summary | {0: 2, 1: 337, 2: 432, 3: 637, 4: 1224} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039856787_1039856797 | 12 | Left | 1039856787 | 8:41421981-41422003 | CCTGTAGTCCCAGCTACTCGGGA | 0: 54379 1: 173656 2: 264604 3: 194654 4: 115454 |
||
| Right | 1039856797 | 8:41422016-41422038 | AGAATGGCGTGAAGCCCAGGGGG | 0: 2 1: 337 2: 432 3: 637 4: 1224 |
||||
| 1039856789_1039856797 | 4 | Left | 1039856789 | 8:41421989-41422011 | CCCAGCTACTCGGGAGGCTGAGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
||
| Right | 1039856797 | 8:41422016-41422038 | AGAATGGCGTGAAGCCCAGGGGG | 0: 2 1: 337 2: 432 3: 637 4: 1224 |
||||
| 1039856791_1039856797 | 3 | Left | 1039856791 | 8:41421990-41422012 | CCAGCTACTCGGGAGGCTGAGGC | 0: 94911 1: 257638 2: 218586 3: 135882 4: 139272 |
||
| Right | 1039856797 | 8:41422016-41422038 | AGAATGGCGTGAAGCCCAGGGGG | 0: 2 1: 337 2: 432 3: 637 4: 1224 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039856797 | Original CRISPR | AGAATGGCGTGAAGCCCAGG GGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||