ID: 1039859823

View in Genome Browser
Species Human (GRCh38)
Location 8:41447525-41447547
Sequence ACCCACTGGCAAGGTTGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039859823_1039859829 4 Left 1039859823 8:41447525-41447547 CCTTGACAACCTTGCCAGTGGGT No data
Right 1039859829 8:41447552-41447574 CCAGTTCAGGTAGAGCTGCCAGG No data
1039859823_1039859832 21 Left 1039859823 8:41447525-41447547 CCTTGACAACCTTGCCAGTGGGT No data
Right 1039859832 8:41447569-41447591 GCCAGGGGTGCCAGACTGAAAGG No data
1039859823_1039859830 5 Left 1039859823 8:41447525-41447547 CCTTGACAACCTTGCCAGTGGGT No data
Right 1039859830 8:41447553-41447575 CAGTTCAGGTAGAGCTGCCAGGG No data
1039859823_1039859831 6 Left 1039859823 8:41447525-41447547 CCTTGACAACCTTGCCAGTGGGT No data
Right 1039859831 8:41447554-41447576 AGTTCAGGTAGAGCTGCCAGGGG No data
1039859823_1039859834 22 Left 1039859823 8:41447525-41447547 CCTTGACAACCTTGCCAGTGGGT No data
Right 1039859834 8:41447570-41447592 CCAGGGGTGCCAGACTGAAAGGG No data
1039859823_1039859826 -9 Left 1039859823 8:41447525-41447547 CCTTGACAACCTTGCCAGTGGGT No data
Right 1039859826 8:41447539-41447561 CCAGTGGGTCATCCCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039859823 Original CRISPR ACCCACTGGCAAGGTTGTCA AGG (reversed) Intergenic
No off target data available for this crispr