ID: 1039859825

View in Genome Browser
Species Human (GRCh38)
Location 8:41447539-41447561
Sequence CCTGAACTGGGATGACCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039859825_1039859837 29 Left 1039859825 8:41447539-41447561 CCAGTGGGTCATCCCAGTTCAGG No data
Right 1039859837 8:41447591-41447613 GGCAGACAGCAGGAGTGAAGTGG No data
1039859825_1039859832 7 Left 1039859825 8:41447539-41447561 CCAGTGGGTCATCCCAGTTCAGG No data
Right 1039859832 8:41447569-41447591 GCCAGGGGTGCCAGACTGAAAGG No data
1039859825_1039859836 19 Left 1039859825 8:41447539-41447561 CCAGTGGGTCATCCCAGTTCAGG No data
Right 1039859836 8:41447581-41447603 AGACTGAAAGGGCAGACAGCAGG No data
1039859825_1039859830 -9 Left 1039859825 8:41447539-41447561 CCAGTGGGTCATCCCAGTTCAGG No data
Right 1039859830 8:41447553-41447575 CAGTTCAGGTAGAGCTGCCAGGG No data
1039859825_1039859834 8 Left 1039859825 8:41447539-41447561 CCAGTGGGTCATCCCAGTTCAGG No data
Right 1039859834 8:41447570-41447592 CCAGGGGTGCCAGACTGAAAGGG No data
1039859825_1039859831 -8 Left 1039859825 8:41447539-41447561 CCAGTGGGTCATCCCAGTTCAGG No data
Right 1039859831 8:41447554-41447576 AGTTCAGGTAGAGCTGCCAGGGG No data
1039859825_1039859829 -10 Left 1039859825 8:41447539-41447561 CCAGTGGGTCATCCCAGTTCAGG No data
Right 1039859829 8:41447552-41447574 CCAGTTCAGGTAGAGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039859825 Original CRISPR CCTGAACTGGGATGACCCAC TGG (reversed) Intergenic
No off target data available for this crispr