ID: 1039859831

View in Genome Browser
Species Human (GRCh38)
Location 8:41447554-41447576
Sequence AGTTCAGGTAGAGCTGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039859825_1039859831 -8 Left 1039859825 8:41447539-41447561 CCAGTGGGTCATCCCAGTTCAGG No data
Right 1039859831 8:41447554-41447576 AGTTCAGGTAGAGCTGCCAGGGG No data
1039859824_1039859831 -3 Left 1039859824 8:41447534-41447556 CCTTGCCAGTGGGTCATCCCAGT No data
Right 1039859831 8:41447554-41447576 AGTTCAGGTAGAGCTGCCAGGGG No data
1039859823_1039859831 6 Left 1039859823 8:41447525-41447547 CCTTGACAACCTTGCCAGTGGGT No data
Right 1039859831 8:41447554-41447576 AGTTCAGGTAGAGCTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039859831 Original CRISPR AGTTCAGGTAGAGCTGCCAG GGG Intergenic
No off target data available for this crispr