ID: 1039859883

View in Genome Browser
Species Human (GRCh38)
Location 8:41448004-41448026
Sequence TTTCTCAGTGTCCCAGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039859878_1039859883 -3 Left 1039859878 8:41447984-41448006 CCCCAAGGGATCGCCCACATTTT No data
Right 1039859883 8:41448004-41448026 TTTCTCAGTGTCCCAGAATCTGG No data
1039859879_1039859883 -4 Left 1039859879 8:41447985-41448007 CCCAAGGGATCGCCCACATTTTC No data
Right 1039859883 8:41448004-41448026 TTTCTCAGTGTCCCAGAATCTGG No data
1039859880_1039859883 -5 Left 1039859880 8:41447986-41448008 CCAAGGGATCGCCCACATTTTCT No data
Right 1039859883 8:41448004-41448026 TTTCTCAGTGTCCCAGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039859883 Original CRISPR TTTCTCAGTGTCCCAGAATC TGG Intergenic
No off target data available for this crispr