ID: 1039863388

View in Genome Browser
Species Human (GRCh38)
Location 8:41479139-41479161
Sequence GGATTTAATGGGAATGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039863388_1039863395 17 Left 1039863388 8:41479139-41479161 CCGTCCACATTCCCATTAAATCC No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039863388 Original CRISPR GGATTTAATGGGAATGTGGA CGG (reversed) Intergenic
No off target data available for this crispr