ID: 1039863395

View in Genome Browser
Species Human (GRCh38)
Location 8:41479179-41479201
Sequence ACTGTCTGCTCACTTCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039863388_1039863395 17 Left 1039863388 8:41479139-41479161 CCGTCCACATTCCCATTAAATCC No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data
1039863387_1039863395 18 Left 1039863387 8:41479138-41479160 CCCGTCCACATTCCCATTAAATC No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data
1039863391_1039863395 5 Left 1039863391 8:41479151-41479173 CCATTAAATCCTGAAGCCATTGG No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data
1039863389_1039863395 13 Left 1039863389 8:41479143-41479165 CCACATTCCCATTAAATCCTGAA No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data
1039863384_1039863395 26 Left 1039863384 8:41479130-41479152 CCCAGCCACCCGTCCACATTCCC No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data
1039863385_1039863395 25 Left 1039863385 8:41479131-41479153 CCAGCCACCCGTCCACATTCCCA No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data
1039863390_1039863395 6 Left 1039863390 8:41479150-41479172 CCCATTAAATCCTGAAGCCATTG No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data
1039863393_1039863395 -4 Left 1039863393 8:41479160-41479182 CCTGAAGCCATTGGTTTTGACTG No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data
1039863386_1039863395 21 Left 1039863386 8:41479135-41479157 CCACCCGTCCACATTCCCATTAA No data
Right 1039863395 8:41479179-41479201 ACTGTCTGCTCACTTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039863395 Original CRISPR ACTGTCTGCTCACTTCTGAG AGG Intergenic
No off target data available for this crispr