ID: 1039864615

View in Genome Browser
Species Human (GRCh38)
Location 8:41490381-41490403
Sequence ACAATCCCCGCGCGGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 19}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039864601_1039864615 17 Left 1039864601 8:41490341-41490363 CCGCAGCCCCACAGCTCGCCCCG No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864607_1039864615 -2 Left 1039864607 8:41490360-41490382 CCCGCCTCTCTCCTTCCGGAAAC No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864600_1039864615 21 Left 1039864600 8:41490337-41490359 CCGGCCGCAGCCCCACAGCTCGC No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864606_1039864615 -1 Left 1039864606 8:41490359-41490381 CCCCGCCTCTCTCCTTCCGGAAA No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864609_1039864615 -6 Left 1039864609 8:41490364-41490386 CCTCTCTCCTTCCGGAAACAATC No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864599_1039864615 22 Left 1039864599 8:41490336-41490358 CCCGGCCGCAGCCCCACAGCTCG No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864608_1039864615 -3 Left 1039864608 8:41490361-41490383 CCGCCTCTCTCCTTCCGGAAACA No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864598_1039864615 23 Left 1039864598 8:41490335-41490357 CCCCGGCCGCAGCCCCACAGCTC No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864604_1039864615 9 Left 1039864604 8:41490349-41490371 CCACAGCTCGCCCCGCCTCTCTC No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864603_1039864615 10 Left 1039864603 8:41490348-41490370 CCCACAGCTCGCCCCGCCTCTCT No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19
1039864602_1039864615 11 Left 1039864602 8:41490347-41490369 CCCCACAGCTCGCCCCGCCTCTC No data
Right 1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039864615 Original CRISPR ACAATCCCCGCGCGGGCGGA AGG Intronic